View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13915_high_17 (Length: 237)
Name: NF13915_high_17
Description: NF13915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13915_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 168
Target Start/End: Complemental strand, 6193521 - 6193370
Alignment:
| Q |
17 |
ctttgagtagggtggtagttcaggcagtgcgactggaattgctctacgtgccagacatccagatgaattgaaacaagaacaggggacatggctaattgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6193521 |
ctttgagtagggtggtagttcaggcagtgcgactggaattgctctacgtgccagacatccagatgaattgaaacaagaacaggggacatggctaattgat |
6193422 |
T |
 |
| Q |
117 |
attgattactatttgtcacaacaggtgcattgtagttcagtacctaatttta |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6193421 |
attgattactatttgtcacaacaggtgcattgtagttcagtgcctaatttta |
6193370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 192 - 237
Target Start/End: Complemental strand, 6193346 - 6193301
Alignment:
| Q |
192 |
ttgattaccaagtactgtactgatctgctcaagtattttcttttcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6193346 |
ttgattaccaagtactgtactgatctgctcaagtattttcttttcc |
6193301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University