View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13915_high_18 (Length: 236)
Name: NF13915_high_18
Description: NF13915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13915_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 10448432 - 10448549
Alignment:
| Q |
1 |
atctttgttgattatgtctctgattctttgtttaggaactatcacgactgttaattgtagaatcgaacttaatgtaaaccaaaaggacaatgttacatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10448432 |
atctttgttgattatgtctctgattctttgtttaggaactatcacgactgttaattgtagaatcaaacttaatgtaaaccaaaaggacaatgttacatat |
10448531 |
T |
 |
| Q |
101 |
ttcatatggtctactaac |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10448532 |
ttcatatggtctactaac |
10448549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 126 - 236
Target Start/End: Original strand, 10448577 - 10448687
Alignment:
| Q |
126 |
caatattcatgcataatgcattaaaaggtaatgtttgctttctgttgattttgcgaagaagtttctttatgacgagtataggaacttaactatgatgcca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10448577 |
caatattcatgcataatgcattaaaaggtaatgtttgctttctgttgattttgcgaagaagtttctttatgacgagtataggaacttaactatgatgcca |
10448676 |
T |
 |
| Q |
226 |
ctctaattttc |
236 |
Q |
| |
|
||||||||||| |
|
|
| T |
10448677 |
ctctaattttc |
10448687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University