View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13915_low_12 (Length: 297)
Name: NF13915_low_12
Description: NF13915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13915_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 16 - 288
Target Start/End: Complemental strand, 20690417 - 20690148
Alignment:
| Q |
16 |
gtgattaacttggttgatgagaacaaaggatcctcttctggttctgacacgtgagttcgctgtaaatcagttattaatactgctggatactactttcaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
20690417 |
gtgattaacttggttgatgagaacaaaggatcctcttctggttctgacacgtgagtttgctgtaaatcagttattaatactgctgg-ta--actttcaat |
20690321 |
T |
 |
| Q |
116 |
gtatgttatgatccgatttaaggaaaaagcatgaactgaagcttttgattttatcatttgtcacaggaaaaagcgtgaacgcgagtttaaggttacaatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20690320 |
gtatgttatgatccgatttaaggaaaaagcgtgaactgaagcttttgattttatcatttgtaacaggaaaaagcgtgaacgcgagtttaaggttacaatt |
20690221 |
T |
 |
| Q |
216 |
aagttagcttcggaacccgatttgaaccatcttgctcagtttctccgtcgtttgcagctggattgtccctatg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20690220 |
aagttagcttcggaacccgatttgaaccatcttgctcagtttctccgtcgtttgcagctggattgtccttatg |
20690148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 161 - 288
Target Start/End: Complemental strand, 20665931 - 20665804
Alignment:
| Q |
161 |
tgattttatcatttgtcacaggaaaaagcgtgaacgcgagtttaaggttacaattaagttagcttcggaacccgatttgaaccatcttgctcagtttctc |
260 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | | || ||||||||||| ||||||||||| |
|
|
| T |
20665931 |
tgattttatcttttgtcacaggaaaaagcgtgaacgcgagtttaaggttacaattaagtttgcttcacagacggacctgaaccatcttactcagtttctc |
20665832 |
T |
 |
| Q |
261 |
cgtcgtttgcagctggattgtccctatg |
288 |
Q |
| |
|
|||||||||||||| |||||||| |||| |
|
|
| T |
20665831 |
cgtcgtttgcagctagattgtccttatg |
20665804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 16 - 82
Target Start/End: Complemental strand, 20666067 - 20666001
Alignment:
| Q |
16 |
gtgattaacttggttgatgagaacaaaggatcctcttctggttctgacacgtgagttcgctgtaaat |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
20666067 |
gtgattaacttggttgatgagaacaaaggatcctcttctggttctgacaagtgagttcgctgaaaat |
20666001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University