View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13915_low_16 (Length: 246)
Name: NF13915_low_16
Description: NF13915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13915_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 114 - 237
Target Start/End: Original strand, 33444207 - 33444330
Alignment:
| Q |
114 |
gtactaaggttaatttggttgtgttgacaaggatgctactggagttcctgctcttgttgatttggcttctatgagggatgccatgaagaatcttggtggt |
213 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33444207 |
gtactaaggttaatttgtttgtgttgacaaggatgctactggagttcctgctcttgttgatttggcttctatgagggatgccatgaagaatcttggtggt |
33444306 |
T |
|
| Q |
214 |
gatcctaacaagattagccctttg |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33444307 |
gatcctaacaagattagccctttg |
33444330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 220
Target Start/End: Original strand, 2229712 - 2229777
Alignment:
| Q |
155 |
gagttcctgctcttgttgatttggcttctatgagggatgccatgaagaatcttggtggtgatccta |
220 |
Q |
| |
|
|||||||||||||| ||||| | ||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
2229712 |
gagttcctgctctttttgatcttgcttctatgagagatgctatgaagaatcttggtggtgatccta |
2229777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 126 - 213
Target Start/End: Complemental strand, 40561051 - 40560964
Alignment:
| Q |
126 |
atttggttgtgttgacaaggatgctactggagttcctgctcttgttgatttggcttctatgagggatgccatgaagaatcttggtggt |
213 |
Q |
| |
|
||||||| ||| ||||||||||||||||| | || ||| |||||||||| | |||||||||||||| ||| ||||| |||| ||||| |
|
|
| T |
40561051 |
atttggtagtgctgacaaggatgctactgcattttctgttcttgttgatgtaacttctatgagggattccacgaagattctttgtggt |
40560964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University