View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13915_low_17 (Length: 237)

Name: NF13915_low_17
Description: NF13915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13915_low_17
NF13915_low_17
[»] chr5 (2 HSPs)
chr5 (17-168)||(6193370-6193521)
chr5 (192-237)||(6193301-6193346)


Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 168
Target Start/End: Complemental strand, 6193521 - 6193370
Alignment:
17 ctttgagtagggtggtagttcaggcagtgcgactggaattgctctacgtgccagacatccagatgaattgaaacaagaacaggggacatggctaattgat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6193521 ctttgagtagggtggtagttcaggcagtgcgactggaattgctctacgtgccagacatccagatgaattgaaacaagaacaggggacatggctaattgat 6193422  T
117 attgattactatttgtcacaacaggtgcattgtagttcagtacctaatttta 168  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||    
6193421 attgattactatttgtcacaacaggtgcattgtagttcagtgcctaatttta 6193370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 192 - 237
Target Start/End: Complemental strand, 6193346 - 6193301
Alignment:
192 ttgattaccaagtactgtactgatctgctcaagtattttcttttcc 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
6193346 ttgattaccaagtactgtactgatctgctcaagtattttcttttcc 6193301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University