View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13915_low_21 (Length: 208)
Name: NF13915_low_21
Description: NF13915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13915_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 13 - 193
Target Start/End: Complemental strand, 1184724 - 1184546
Alignment:
| Q |
13 |
gcaaaggagaagcatcacaacaacgtggaagctatagaatttcaatgcgtgctgtgaaagtgtgaccatattatatactctctcactgttttgtgaaaga |
112 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1184724 |
gcaaaagagaagcatgacaacaacgtggaagctatagaatttcaatgcgtggtgtaaaagtgtgaccatattatatactctctcactgttttgtgaaaga |
1184625 |
T |
 |
| Q |
113 |
aagnnnnnnnnnntgtaatgtggatgatgatggcttcgagaacaattcattaatcatgcagcatgtgttcaagcatcaaat |
193 |
Q |
| |
|
||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1184624 |
aag--aaaaaaaatgtaatgtggatgatcatggcttcgagaacaattcattaatcatgcagcatgtgttcaagcatcaaat |
1184546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University