View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13916_high_16 (Length: 323)
Name: NF13916_high_16
Description: NF13916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13916_high_16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 19 - 323
Target Start/End: Complemental strand, 34387958 - 34387654
Alignment:
| Q |
19 |
agatggtgccggttctggtcttagagcattacctccaaggatgtcagagtttattctagggtctggatttgaaagggtgatggaacaactttctcatgtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34387958 |
agatggtgccggttctggtcttagagcattacctccaaggatgtcagagcttattctagggtctggatttgaaagggtgatggaacaactttctcatgtt |
34387859 |
T |
 |
| Q |
119 |
gaagctaatcgtagtggaaacgagggacataatcaacaacatttaccggcattaaaatccgcggtggaattgttaccgacgattgaaatcaacgagagtc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34387858 |
gaagctaatcgtagtggaaacgagggacataatcaacaacatttaccggcattaaaatccgcggtggaattgttaccgacgattgaaatcaacgagagtc |
34387759 |
T |
 |
| Q |
219 |
atatgaatgtagaatcacattgtgccgtttgtaaagagccttttgaacttggaatttcagctagtgaaatgccatgcaaacacatataccataatgaatg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34387758 |
atatgaatgtagaatcacattgtgccgtttgtaaagagccttttgaacttggaatttcagctagggaaatgccatgcaaacacatataccataatgaatg |
34387659 |
T |
 |
| Q |
319 |
catac |
323 |
Q |
| |
|
||||| |
|
|
| T |
34387658 |
catac |
34387654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University