View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13916_high_22 (Length: 260)
Name: NF13916_high_22
Description: NF13916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13916_high_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 244
Target Start/End: Original strand, 10274544 - 10274775
Alignment:
| Q |
13 |
gagagagaggatgaattaataaaaagtgacgtgtggccaactaaacttatagacaagaaactcaaaataaagaatgagaatttcacacacataagtggnn |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10274544 |
gagagggaggatgaattaataaaaagtgaagtgtagccaactaaacttatagacaagaaactcaaaacaaagaatgagaatttcacacacataagtggtt |
10274643 |
T |
 |
| Q |
113 |
nnnnnatgcattggattgctttgcattgtttgttatcaatgatgcaaaataagccataaaaaccaattcaaaagagttcatgcttgagttatttcttgaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10274644 |
tttttatgcattggattgctttgcattgtttgttatcaatgatgcaaaataagccataacaaccaattcaaaagagttcatgcttgagttatttcttgga |
10274743 |
T |
 |
| Q |
213 |
aattttgatatgcacactcaaacaaacattac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10274744 |
aattttgatatgcacactcaaacaaacattac |
10274775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University