View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13916_high_23 (Length: 260)
Name: NF13916_high_23
Description: NF13916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13916_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 8152313 - 8152474
Alignment:
| Q |
1 |
aaacacttgtagaccgatgcgattaacaccgcatatcatgtcttacatagaataatcattagaccaatccttctagaactttggtagcagcagaatttca |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8152313 |
aaacacttttagaccgatgcgattaacaccgcatatcatgtcttacatagaataatcattagaccaatccttctagaactttggtagcagcagaatttca |
8152412 |
T |
 |
| Q |
101 |
gtttaaaatagatgttgtcattaaattatagttgcatttcctattttgtttgtgtctttggctgg |
165 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8152413 |
gtttaaaatagatgtt---attaaattatagttgcatttcctattttgtttgtgtctttggctgg |
8152474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 169 - 226
Target Start/End: Original strand, 8152501 - 8152558
Alignment:
| Q |
169 |
gttgattcatactattaattattctctatacgctgtgaaaatttatatcattttttat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8152501 |
gttgattcatactattaattattctctatacgttgtgaaaatttatatcattttttat |
8152558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 228
Target Start/End: Complemental strand, 39615202 - 39615158
Alignment:
| Q |
184 |
taattattctctatacgctgtgaaaatttatatcattttttattt |
228 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||| |
|
|
| T |
39615202 |
taattattctctatacgttgtgtaaatttatatctatttttattt |
39615158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University