View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13916_low_20 (Length: 294)
Name: NF13916_low_20
Description: NF13916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13916_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 3 - 259
Target Start/End: Original strand, 40669828 - 40670098
Alignment:
| Q |
3 |
atcaagatagattttctatgtggccctgaaaacgacatgatctataccacttctaatata-----------------tctcaaatattttgcttagctga |
85 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
40669828 |
atcaagatagattttctacgtggccctgaaaacgacatgatctataccacttctaatatacagtatacacacatatctcttaaatattttgcttagctga |
40669927 |
T |
 |
| Q |
86 |
attaaatatttcacgggatgttgtatttcttgctgtaaattattgttttaaacaataccaccgttactgcttggtcgctttctaggaaaatttggttgat |
185 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40669928 |
attaaatatttcatggaatgttgtatttcttgctgtaaattattgttttaaacaataccaccgttactgcttggtcgctttctaggaaaatttggtagat |
40670027 |
T |
 |
| Q |
186 |
aattccactctatcaacacattctggaccaaagaaatggaaatagcttctttgtccatatccttgttttaatgg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40670028 |
aattccactctatcaacacattctggaccaaagaaatggaaatag---ctttgtccatatccttgttttaatgg |
40670098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University