View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13916_low_23 (Length: 279)
Name: NF13916_low_23
Description: NF13916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13916_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 11 - 214
Target Start/End: Complemental strand, 35850679 - 35850476
Alignment:
| Q |
11 |
cataggagcaagtgtggtagtgaccgtattatctttaacttgaagctgctggttcaaagttatggatgatcttccttgtgtatttaaggttgttgatggc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35850679 |
cataggagcaagtgtggtagtgaccgtattatctttaacttgaagctgctgattcaaagttatggatgatcttccttgtgtatttaaggttgttgatggc |
35850580 |
T |
|
| Q |
111 |
ataactagttcattgctcatgtagcttggtctccaagattgatgatttaagtaccattcttggtgcctaagtnnnnnnntgtaactttaatgccacttga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35850579 |
ataactagttcattgctcatgtagcttggtctccaagattgatgatttaagtaccattcttggtgcctaagtaaaaaaatgtaactttaatgccacttga |
35850480 |
T |
|
| Q |
211 |
atgg |
214 |
Q |
| |
|
|||| |
|
|
| T |
35850479 |
atgg |
35850476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 69 - 176
Target Start/End: Complemental strand, 35857000 - 35856893
Alignment:
| Q |
69 |
gttatggatgatcttccttgtgtatttaaggttgttgatggcataactagttcattgctcatgtagcttggtctccaagattgatgatttaagtaccatt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35857000 |
gttatggatgatcttccttgtgtatttatggctgttgatggcataactaattcattgctcatgtagcttggtctcaaagattgatgatttaagtaccatt |
35856901 |
T |
|
| Q |
169 |
cttggtgc |
176 |
Q |
| |
|
|||||||| |
|
|
| T |
35856900 |
cttggtgc |
35856893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University