View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13916_low_25 (Length: 260)

Name: NF13916_low_25
Description: NF13916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13916_low_25
NF13916_low_25
[»] chr8 (2 HSPs)
chr8 (1-165)||(8152313-8152474)
chr8 (169-226)||(8152501-8152558)
[»] chr7 (1 HSPs)
chr7 (184-228)||(39615158-39615202)


Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 8152313 - 8152474
Alignment:
1 aaacacttgtagaccgatgcgattaacaccgcatatcatgtcttacatagaataatcattagaccaatccttctagaactttggtagcagcagaatttca 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8152313 aaacacttttagaccgatgcgattaacaccgcatatcatgtcttacatagaataatcattagaccaatccttctagaactttggtagcagcagaatttca 8152412  T
101 gtttaaaatagatgttgtcattaaattatagttgcatttcctattttgtttgtgtctttggctgg 165  Q
    ||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||    
8152413 gtttaaaatagatgtt---attaaattatagttgcatttcctattttgtttgtgtctttggctgg 8152474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 169 - 226
Target Start/End: Original strand, 8152501 - 8152558
Alignment:
169 gttgattcatactattaattattctctatacgctgtgaaaatttatatcattttttat 226  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
8152501 gttgattcatactattaattattctctatacgttgtgaaaatttatatcattttttat 8152558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 228
Target Start/End: Complemental strand, 39615202 - 39615158
Alignment:
184 taattattctctatacgctgtgaaaatttatatcattttttattt 228  Q
    ||||||||||||||||| |||| |||||||||||  |||||||||    
39615202 taattattctctatacgttgtgtaaatttatatctatttttattt 39615158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University