View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13917_high_4 (Length: 338)
Name: NF13917_high_4
Description: NF13917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13917_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 2 - 322
Target Start/End: Original strand, 35578647 - 35578967
Alignment:
| Q |
2 |
atagcacgttgattactgcgttatgtcgtgatggaaaaattgatgaggcaaagaatgtgttgaaggttatgaaggagaaagcgctggctcccgatggtta |
101 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35578647 |
atagtacgttgattactgcgttatgtcgtgatggaaaaattgacgaggcaaagaatgtgttgaaggttatgaaggagaaagcgctggctcctgatggtta |
35578746 |
T |
 |
| Q |
102 |
tagttatgatccattgatttctgctctttgtagagaaggaaaagtggatttggctattgagtttttggatgacctgatatcaggtggtcatttgcctgat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35578747 |
tagttatgatccattgatttctgctctttgtagagaaggaaaagtggatttggctattgagtttttggatgacatgatatcaggtggtcatttgcctgat |
35578846 |
T |
 |
| Q |
202 |
attcttagctataactcaatcttggcatctttgtgtaagaatggaaatgccgatgaggctttgaatatctttgagaagcttggtgaagtgggttgtcctc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35578847 |
attcttagctataactcaatcttggcatctttgtgtaagaatggaaatgccgatgaggctttgaatatctttgagaagcttggtgaagtgggttgtcctc |
35578946 |
T |
 |
| Q |
302 |
caaatgcaggttcttataata |
322 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35578947 |
caaatgcaggttcttataata |
35578967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University