View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13918_high_10 (Length: 203)
Name: NF13918_high_10
Description: NF13918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13918_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 10 - 180
Target Start/End: Original strand, 40764140 - 40764310
Alignment:
| Q |
10 |
tagattatactaaagatttctttgcccgtcaagcatttttgactgtttctggtcagcttcaagttgagtcttatgcgtgtgctcttagtagtgtgtatac |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40764140 |
tagattatgctaaagatttctttgcccgtcaagcatttttgactgtttctggtcagcttcaagttgagtcttatgcgtgtgctcttagtagtgtgtatac |
40764239 |
T |
|
| Q |
110 |
atttggcccaacatttcgtgcagagaattctcacacttccaggcatttggctgaattttggatggtagaac |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40764240 |
atttggcccaacatttcgtgcagagaattctcacacttccaggcatttggctgaattttggatggtagaac |
40764310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 12 - 180
Target Start/End: Original strand, 42911789 - 42911957
Alignment:
| Q |
12 |
gattatactaaagatttctttgcccgtcaagcatttttgactgtttctggtcagcttcaagttgagtcttatgcgtgtgctcttagtagtgtgtatacat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||| |
|
|
| T |
42911789 |
gattatactaaagatttctttgcccgtcaagcgtttttgactgtttctggtcagcttcaagttgagtcttatgcttgtgctcttagtcgcgtgtatacat |
42911888 |
T |
|
| Q |
112 |
ttggcccaacatttcgtgcagagaattctcacacttccaggcatttggctgaattttggatggtagaac |
180 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42911889 |
ttggcccgacatttcgtgcagagaattctcacacttccaggcatttggctgaattttggatggtagaac |
42911957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 41661999 - 41661931
Alignment:
| Q |
102 |
gtgtatacatttggcccaacatttcgtgcagagaattctcacacttccaggcatttggctgaattttgg |
170 |
Q |
| |
|
|||||||||||||| || |||||||| |||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
41661999 |
gtgtatacatttggtcccacatttcgagcagagaattctaacacttccaggcacttggctgaattttgg |
41661931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University