View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13919_low_4 (Length: 278)
Name: NF13919_low_4
Description: NF13919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13919_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 218
Target Start/End: Original strand, 33751122 - 33751324
Alignment:
| Q |
16 |
attgccttgatatatacctgcaagtgcaaatcgtgattttaatgtaatctgctttctaaaatattctacttaatgtgtggctttgttgaattatattata |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
33751122 |
attgccttgatatatacctgcaactgcaaatcgtgattttaatgtaatctgctttctaaaatattgtacttaatgtgtggctttattgaattatattata |
33751221 |
T |
|
| Q |
116 |
gtataaatactagttctgttcactgattttgtctttttagcttaaagggttatatattcagcttcaatgagtacattgttttttaataaggataagaata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33751222 |
gtataaatactagttctgttcactgattttgtctttttagcttaaagggttatatattcagcttcaatgagtgcattgttttttaataaggataagaata |
33751321 |
T |
|
| Q |
216 |
taa |
218 |
Q |
| |
|
||| |
|
|
| T |
33751322 |
taa |
33751324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 29 - 57
Target Start/End: Original strand, 32575995 - 32576023
Alignment:
| Q |
29 |
atacctgcaagtgcaaatcgtgattttaa |
57 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32575995 |
atacctgcaagtgcaaatcgtgattttaa |
32576023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University