View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13919_low_6 (Length: 210)
Name: NF13919_low_6
Description: NF13919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13919_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 55 - 192
Target Start/End: Complemental strand, 39937900 - 39937763
Alignment:
| Q |
55 |
gtcctttaactttttccaccataggtctcgacatttccaaattcatcatgagttcacccctacgaggcgcttcatatacgttttccgcggaacacaatga |
154 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
39937900 |
gtcctttaactttttccaccatcggtctcgacatttccgaattcatcatgagttcacccctacgaggcgcttcagatacgttttccgcataacactatga |
39937801 |
T |
 |
| Q |
155 |
cttacattttcaatttgctatttttccgaagcattctt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39937800 |
cttacattttcaatttgctatttttccgaagcattctt |
39937763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University