View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1391A-Insertion-13 (Length: 194)

Name: NF1391A-Insertion-13
Description: NF1391A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1391A-Insertion-13
NF1391A-Insertion-13
[»] chr3 (1 HSPs)
chr3 (81-177)||(24566719-24566815)
[»] chr8 (1 HSPs)
chr8 (85-138)||(44339976-44340029)


Alignment Details
Target: chr3 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 81 - 177
Target Start/End: Original strand, 24566719 - 24566815
Alignment:
81 tctctctctcgtggatggtttctgcattgtcgccctatttgtggaatttgtttagaaaagaggnnnnnnnnngtaaacaaaatcttgagccagactg 177  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||         |||||||||||||||||||||||||    
24566719 tctctctctcgtggatggtttctgcattgtcgccctatttgtggaatttgtttagaaaataggaaaaaaaaagtaaacaaaatcttgagccagactg 24566815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 85 - 138
Target Start/End: Original strand, 44339976 - 44340029
Alignment:
85 tctctcgtggatggtttctgcattgtcgccctatttgtggaatttgtttagaaa 138  Q
    |||||| |||||||||||||||| ||| |||||||| |||||||||||||||||    
44339976 tctctcatggatggtttctgcatcgtccccctatttctggaatttgtttagaaa 44340029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University