View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1391A-Insertion-15 (Length: 299)
Name: NF1391A-Insertion-15
Description: NF1391A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1391A-Insertion-15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 7 - 140
Target Start/End: Original strand, 45801392 - 45801525
Alignment:
| Q |
7 |
atcttcgccgtcgtatactgcgcctccgcgttagttgttgctccacctccgcccatctgatcttatcaccgatcttatctccgatcttaatttcacaaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45801392 |
atcttcgccgtcgtatactgcgcctccgcgttagttgttgctccacctccgcccatctgatcttatcaccgatcttatctccgatcttaatttcacaaag |
45801491 |
T |
|
| Q |
107 |
atcgattcgaagtaactatacaaattacaaaacc |
140 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
45801492 |
atcgattcaaagtaactatacaaattacaaaacc |
45801525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 197 - 299
Target Start/End: Original strand, 45801582 - 45801684
Alignment:
| Q |
197 |
cactcattgattgatcgatgatgatttatgtgacagaagaaacgatagagtcaaagcatagtataaaatagatatggtggagagatagagggttttgttt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45801582 |
cactcattgattgatcgatgatgatttatgtgacagaagaaacgatagagtcaaagcatagtataaaatagatatggtggagagatagagggttttgttt |
45801681 |
T |
|
| Q |
297 |
tgg |
299 |
Q |
| |
|
||| |
|
|
| T |
45801682 |
tgg |
45801684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University