View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1391A-Insertion-19 (Length: 52)
Name: NF1391A-Insertion-19
Description: NF1391A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1391A-Insertion-19 |
 | |
|
| [»] chr8 (4 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 45; Significance: 1e-17; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-17
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 31385037 - 31385081
Alignment:
| Q |
8 |
attcattcaccgttattctctttatccacccatcttcacaaccag |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31385037 |
attcattcaccgttattctctttatccacccatcttcacaaccag |
31385081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 11 - 52
Target Start/End: Original strand, 31370420 - 31370461
Alignment:
| Q |
11 |
cattcaccgttattctctttatccacccatcttcacaaccag |
52 |
Q |
| |
|
||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
31370420 |
cattcactgatattctcttaatccacccatcttcacaaccag |
31370461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 11 - 52
Target Start/End: Original strand, 31405553 - 31405594
Alignment:
| Q |
11 |
cattcaccgttattctctttatccacccatcttcacaaccag |
52 |
Q |
| |
|
||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
31405553 |
cattcactgatattctcttaatccacccatcttcacaaccag |
31405594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 27; E-Value: 0.0000008
Query Start/End: Original strand, 8 - 42
Target Start/End: Complemental strand, 31932816 - 31932782
Alignment:
| Q |
8 |
attcattcaccgttattctctttatccacccatct |
42 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||| |
|
|
| T |
31932816 |
attcattcactgtgattctctttatccacccatct |
31932782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University