View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1391_low_10 (Length: 237)
Name: NF1391_low_10
Description: NF1391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1391_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 21 - 152
Target Start/End: Original strand, 13740527 - 13740658
Alignment:
| Q |
21 |
gcaggctttacttggagtcatatttatttttgtttgtgattttgctacttgttgtttgtctgaggtgaacttctaggggcatgttttagttatgggggta |
120 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13740527 |
gcaggctttacttggagtcatatttgtttttgtttgtaattttgctacatgttgtttgtctgaggtgaacttctaggggcatgttttagttatgggggta |
13740626 |
T |
|
| Q |
121 |
ttgtggagtggagtgttttgtattgttctgtg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13740627 |
ttgtggagtggagtgttttgtattgttctgtg |
13740658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 21 - 152
Target Start/End: Original strand, 13746027 - 13746158
Alignment:
| Q |
21 |
gcaggctttacttggagtcatatttatttttgtttgtgattttgctacttgttgtttgtctgaggtgaacttctaggggcatgttttagttatgggggta |
120 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13746027 |
gcaggctttacttggagtcatatttgtttttgtttgtaattttgctacatgttgtttgtctgaggtgaacttctaggggcatgttttagttatgggggta |
13746126 |
T |
|
| Q |
121 |
ttgtggagtggagtgttttgtattgttctgtg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13746127 |
ttgtggagtggagtgttttgtattgttctgtg |
13746158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University