View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1391_low_7 (Length: 277)
Name: NF1391_low_7
Description: NF1391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1391_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 31 - 164
Target Start/End: Original strand, 45801264 - 45801397
Alignment:
| Q |
31 |
cataggcggagatggaaacgggaccacaatagttcatacgaacaagtgctgaactgatattctgcgcaattgcatgtggatcggagcctttaggaacatg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45801264 |
cataggcggagatggaaacgggaccacaatagttcatacgaacaagtgctgaactgatattctgcgcaattgcatgtggatcggagcctttaggaacatg |
45801363 |
T |
 |
| Q |
131 |
acagttctctatatcccaccataccgatatcttc |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45801364 |
acagttctctatatcccaccataccgatatcttc |
45801397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University