View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13920_low_15 (Length: 321)
Name: NF13920_low_15
Description: NF13920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13920_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 304
Target Start/End: Complemental strand, 27328355 - 27328068
Alignment:
| Q |
18 |
ggacagatgcaaacaatcttgataatatgagcaacgatcatgttcgagtgtgtctatggtgtttctccatgttgtggtacgttcaagagttactgacttt |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27328355 |
ggacagctgcaaacaatcttgataatatgatcaacgatcatgttcgagtgtgtctatggtgtttgtccatgttgtggtacgttcaagagttactgacttt |
27328256 |
T |
 |
| Q |
118 |
gggtgacctggatcattgatcaattggacattggcccggtctgaaacaattgctcccct-acctttaattgacgaagtaagatgatgacatgtgttcagt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27328255 |
gggtgacctggatcattgatcaattggacattggcccggtctgaaacaattgctcccctaacctttaatcgacgaagtaagatgatgacatgtgttcagt |
27328156 |
T |
 |
| Q |
217 |
ccatgcttttagagccgtttcatgctacttcttttgcggcctcaagagatttatttatttattttacaatgaagtggattctttgcgg |
304 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27328155 |
ccattctttcagagccgtttcatgctacttcttttgcggcctcaagagatttatttatttattttacaatgaagtggattctttgcgg |
27328068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University