View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13920_low_17 (Length: 278)
Name: NF13920_low_17
Description: NF13920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13920_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 37053729 - 37053830
Alignment:
| Q |
1 |
aaaacagacccctaatgaggtaggttggagtcaaaatattacactgcagtaacaaccaaaggtgggtcgcaattcttgatactaagcagaatcacactca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | || |||||| ||||||| ||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
37053729 |
aaaacagacccctaatgaggtaggttggagtcaaaatattaaaatgaagtaacgaccaaagtcgggtcacaattcttgatactacgcaaaatcacactca |
37053828 |
T |
 |
| Q |
101 |
aa |
102 |
Q |
| |
|
|| |
|
|
| T |
37053829 |
aa |
37053830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 106 - 241
Target Start/End: Original strand, 36675880 - 36676009
Alignment:
| Q |
106 |
gaataaaatggaagataaaagataagtttttgtgcctaaactaaaagcatatttatattgtcattaaactggaggttggagttttgtggtatcatatatt |
205 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| | || ||||||||| ||| |||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
36675880 |
gaataaaatggaaggtaaaagataagtttttgtgcctaag--agcaggatatttatactgtaattaaattggaggttggagttttgaattatcatatatt |
36675977 |
T |
 |
| Q |
206 |
ctgactctgcactttaaaattcaaattcctaaagca |
241 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |
|
|
| T |
36675978 |
----ctctacactttaaaattcaaattcctaaagca |
36676009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University