View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13920_low_19 (Length: 269)
Name: NF13920_low_19
Description: NF13920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13920_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 248
Target Start/End: Complemental strand, 7215067 - 7214840
Alignment:
| Q |
21 |
ataacaacaacaatatggttcaccctgtttcactaccagttcatcataaccatgctagagaagtgaagcattacaaaaaatggtttccttggttgttacc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7215067 |
ataacaacaacaatatggttcaccctgtttcactaccagttcatcataaccatgctagagaagtgaagcattacaaaaaatggtttccttggttgttacc |
7214968 |
T |
 |
| Q |
121 |
gttttttgttgttgctaacatcgtggtttttgttatcactatgtatgttaataattgtcccaagaattctgtttcttgtattgcgaggtttctcaagcgt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7214967 |
gttttttgttgttgctaacatcgtggtttttgttatcactatgtatgttaataattgtcccaagaattctgtttcttgtattgcgaggtttctcaagcgt |
7214868 |
T |
 |
| Q |
221 |
ttcgcttttcagcctcttaaggaaaatc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7214867 |
ttcgcttttcagcctcttaaggaaaatc |
7214840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University