View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13920_low_20 (Length: 263)
Name: NF13920_low_20
Description: NF13920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13920_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 24 - 169
Target Start/End: Complemental strand, 49180465 - 49180320
Alignment:
| Q |
24 |
agacacagtctcaaacctgacttccagccctgtagcagcaaactcatcttatacgtggcatatagccatttttgtaagtcactgcattaaacaaagaatt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49180465 |
agacacagtctcaaacctgacttccagccctgtagcagcaaactcatcttatacgtggcatatagccatttttgtaagtcactgcattgaacaaagaatt |
49180366 |
T |
|
| Q |
124 |
taacaggaatccttccccgcgttcaatagcaactagcagcattttc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180365 |
taacaggaatccttccccgcgttcaatagcaactagcagcattttc |
49180320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 164 - 257
Target Start/End: Complemental strand, 49180247 - 49180154
Alignment:
| Q |
164 |
attttcccacaaaagttaacaattatgtagttgtcaaccatgcaataggtgaaggacaaatttagtgattttcacctttaatgacctatgcttc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49180247 |
attttcccacaaaagttaacaattatgtagttgtcaaccatgcaataggtgaaggacaaatttagtgattttcacctttaatgacctaagcttc |
49180154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University