View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13920_low_24 (Length: 225)
Name: NF13920_low_24
Description: NF13920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13920_low_24 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 10 - 225
Target Start/End: Original strand, 36726686 - 36726904
Alignment:
| Q |
10 |
ataatactgatacatatttttggcttgatcctttgttggaagaggggaggttgtgtgattggtggta----gaaaaatatgttagggtgacaaatatgct |
105 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| ||| |||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36726686 |
ataataatgatacatatttttggcttgatcctttgttggaagaggagagattgtgtaattggtggtacgtagaaaaatatgttagggtgacaaatatgct |
36726785 |
T |
|
| Q |
106 |
ttgcttgagtgagaatgttggagattcccaaaggaaaatcaaaccacctaggatggaagaaatgttaaggtcatcaaggcgcatgaatgaatctaaagag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36726786 |
ttgcttgagtgagaatgttggagattcccaaaggaaaa-caaaccacctaggatggaagaaatgttaaggtcatcaaggcgcatgaatgaatctaaagag |
36726884 |
T |
|
| Q |
206 |
aagaagacgatgcaaagaag |
225 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
36726885 |
aagaagacgatgcaaagaag |
36726904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University