View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13920_low_9 (Length: 460)
Name: NF13920_low_9
Description: NF13920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13920_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 164 - 442
Target Start/End: Original strand, 27328409 - 27328687
Alignment:
| Q |
164 |
taaacctaaaacctcacattcacaacactttcttgcttgatcgtcggtttgtaaatacaatacatcgtcttgttgagatgctgctcattgtccaccaccc |
263 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27328409 |
taaagctaaaacctcacattcacaacactttcttgcttgatcgtcggtttgtaaatacaatacatcgtcttgttgagatgctgctcattgtccaccaccc |
27328508 |
T |
|
| Q |
264 |
agtaatccttcaaacttaagatcttaggtcagtaaggatctgttatcactcgtgtgtcagaccactcctaaaatttctagcttcgtaataattatggttg |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27328509 |
agtaatccttcaaacttaagatcttaggtctggaaggatcagttatcactcgtgtgtccaaccactcctaaaatttctagcttcgtaataattatggttg |
27328608 |
T |
|
| Q |
364 |
gttgcataggacgtgataattgcttttatatcaaacaactaacacataccaggcataacctagtttaagtagaacatga |
442 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27328609 |
gttgcataggacgtgataattgcttttatatcaaacaactagcacataccaggcataacctagtttaagtagaacatga |
27328687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 16 - 128
Target Start/End: Original strand, 27328301 - 27328414
Alignment:
| Q |
16 |
agacacactcgaacatgatcgttgatcatattatcaagattgtttgcagctgtccattcagacagctgt-----ccaggattttggatcctaaaacatta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| | |||||||||||||||||||||||| |
|
|
| T |
27328301 |
agacacactcgaacatgatcgttgatcatattatcaagattgtttgcagctgtc----cgaacagctgtctaagctaggattttggatcctaaaacatta |
27328396 |
T |
|
| Q |
111 |
attcttccactataaagc |
128 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
27328397 |
attcctccactataaagc |
27328414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University