View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13922_high_20 (Length: 220)
Name: NF13922_high_20
Description: NF13922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13922_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 14 - 203
Target Start/End: Original strand, 31948660 - 31948838
Alignment:
| Q |
14 |
cagagagggtgacggcagtttgtaccggtgggaagcttgtagtgacggtgccaaagatcaaagggaactaatattcgatcttcatgcgatagaatgaata |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31948660 |
cagagagggtgacggcggtttgtaccggtgggaagcttgtagtgacggtgccaaagatcaaagggaactaatattcgatctt-----------atgaata |
31948748 |
T |
|
| Q |
114 |
tatatatgtacaccttacaccatggtatatatctcactttagaggccaaattcatcacatgactcacatatatgaatttatgacatgtat |
203 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31948749 |
tatatatgtacaccttacaccgtggtagatatctcactttagaggccaaattcatcacatgactcacatatatgaatttatgacatgtat |
31948838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University