View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13922_low_19 (Length: 241)
Name: NF13922_low_19
Description: NF13922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13922_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 3 - 216
Target Start/End: Original strand, 12746539 - 12746753
Alignment:
| Q |
3 |
attcattgaattttgaatagggnnnnnnnaatcaacaaattaattgatttttaaggactgatatttgttattttagttaaagaccattacacaattcttt |
102 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
12746539 |
attcattgaattttgaatagggtttttttaatcaacaaattaattgatttttaaggacttatatttgttatttaagttaaagaccattacccaattcttt |
12746638 |
T |
|
| Q |
103 |
gataaacnnnnnnnngggtg-nnnnnnnnnnnnggttaagagtgttgcactctatcaagtgagctagacaggtttgatagattcaattatatgagatcat |
201 |
Q |
| |
|
||||| | ||||| ||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||| | ||||| |
|
|
| T |
12746639 |
gataagcttttttttgggtgaaaaaaaaaattaagttaagagtgttggactctatcaactgagctagacgggtttgatagattcaattatatcatatcat |
12746738 |
T |
|
| Q |
202 |
atattgactttagat |
216 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
12746739 |
atattgactttagat |
12746753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University