View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13922_low_3 (Length: 576)
Name: NF13922_low_3
Description: NF13922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13922_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 42003354 - 42003576
Alignment:
| Q |
6 |
atggacatcatcatgtgaatttatttcgtcagctttgataccggtggaagaggcgaattggttgttttggactgattattattctaacatacccttgcag |
105 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003354 |
atggacatcattatgtgaatttatttcgtcaactttgatacctgtggaagagacgaattggttgttttggactgattattattctaacatacccttgcag |
42003453 |
T |
|
| Q |
106 |
tgggatgatcctggttgtggaaactgtgaagcacgtggaggaagatgtggattggttggggatgatgctcttcgtcttgcttgttatgatcttcccaccc |
205 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003454 |
tgggatgatcctgattgtggaaattgtgaagcacgtggaggaagatgtggattggttggggatgatgctcttcgtcttgcttgttatgatcttcccaccc |
42003553 |
T |
|
| Q |
206 |
aaggtcagaaatagtcaatgatg |
228 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
42003554 |
aaggtgagaaatagtcaatgatg |
42003576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 148; E-Value: 8e-78
Query Start/End: Original strand, 399 - 558
Target Start/End: Original strand, 42003640 - 42003799
Alignment:
| Q |
399 |
tatttatgtaggtctttcgaggaaagtcaagtatggtttaagcctaggtttgggaatacctggactcctaggtctaattatgcttacatggatgttatgc |
498 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42003640 |
tatttatgtaggtctttcaaggaaagtcaagtatggtttaagcctaggtttgggaatacctggactcctaggtctaattatgcttacattgatgttatgc |
42003739 |
T |
|
| Q |
499 |
aaaaagaagtacacaaggaatcaagtacaacgtcaaacaagcactgaattttcaaccttt |
558 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003740 |
aaaaacaagtacacaaggaatcaagtacaacgtcaaacaagcactgaattttcaaccttt |
42003799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University