View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13922_low_9 (Length: 363)
Name: NF13922_low_9
Description: NF13922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13922_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 1 - 348
Target Start/End: Original strand, 14002756 - 14003103
Alignment:
| Q |
1 |
aggaaggtttatacaatcttgctagtcgattgctccggatttttcagcagagaaaggagagagatgcaaaagatgcagcatttgttaaagtagataataa |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
14002756 |
aggaaggtttatacaatcttgctcgtcgattgctccggatttttcagcagagaaaggagagagatgcaaaagatgcagcatttgttaaagtagataacaa |
14002855 |
T |
|
| Q |
101 |
aattagagcactttctgaggtgattataaggatgagaatggaaggaggaactaaaattgaaatcaaggaggttaacaaagaagcaaataaaaagggttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14002856 |
aattagagcactttctgaggtgattataaggatgagaatggaaggaggaactaaaattgaaatcaaggaggttaacaaagaagcaaataaaaagggttgt |
14002955 |
T |
|
| Q |
201 |
gcttttacaccaaattttagacccaaaaaatgtttgaaagaagttaagaagattgattgggagaagagtttaagggcaggttcaagccctgttcctgtga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14002956 |
gcttttacaccaaattttagacccaaaaaatgtttgaaagaagttaagaagattgattgggagaagagtttaagggcaggttcaagccctgttcctgtga |
14003055 |
T |
|
| Q |
301 |
aaggatcatatgttagatcaaagcaaaaggataaaataatgatgaggg |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003056 |
aaggatcatatgttagatcaaagcaaaaggataaaataatgatgaggg |
14003103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University