View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13923_high_20 (Length: 319)
Name: NF13923_high_20
Description: NF13923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13923_high_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 6 - 319
Target Start/End: Original strand, 5957666 - 5957979
Alignment:
| Q |
6 |
ggagcagcacagagggagtttctacctacggtgcgtgtgcacgagtttccaatggacccagatatatacaccgaatggaagatgttacaatggaagccgc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5957666 |
ggagcagcacagagggagtttctacctacggtgcgtgtgcaggagtttccaatggacccagatatatacacagaatggaagatgttacaatggaagccgc |
5957765 |
T |
 |
| Q |
106 |
cggagtttgcgcgagcacctggtgggccaccgtcgaatgtggcggtggcccatgtcaggcttggcggacgggcggctttgttggggaaagttggggagga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957766 |
cggagtttgcgcgagcacctggtgggccgccgtcgaatgtggcggtggcccatgtcaggcttggcggacgggcggctttgttggggaaagttggggagga |
5957865 |
T |
 |
| Q |
206 |
tgagtttggggaggagattgttttggggatgaataaggagaaggtgcagactagaggggtgaagtttgattcggggtttcggactgggtgtagttatatg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957866 |
tgagtttggggaggagattgttttggggatgaataaggagaaggtgcagactagaggggtgaagtttgattcggggtttcggactgggtgtagttatatg |
5957965 |
T |
 |
| Q |
306 |
aaggtgaagtttga |
319 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5957966 |
aaggtgaagtttga |
5957979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University