View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13925_high_12 (Length: 434)
Name: NF13925_high_12
Description: NF13925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13925_high_12 |
 |  |
|
| [»] scaffold1429 (1 HSPs) |
 |  |  |
|
| [»] scaffold0352 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1429 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: scaffold1429
Description:
Target: scaffold1429; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 253
Target Start/End: Complemental strand, 1475 - 1238
Alignment:
| Q |
16 |
atagtaagatgatcaagattatgactaaggtttgcaagtgagtctgcacactgattaccttctctatagacatgtgtgatcaagaagttcattttatagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1475 |
atagtaagatgatcaagattatgactaaggtttgcaagtgagtctgcacactaattaccttctctatagacatgtgtgatcaagaagttcattttatagg |
1376 |
T |
 |
| Q |
116 |
ttagcgagagacagttcagccatctgtttcttaacttccaaggaactatattagggtttatgactgctttggttacgagcacagaatctgtttccagcca |
215 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||| |||||||||||||||| |
|
|
| T |
1375 |
ttagcgagagacagttcaaccagctgtttcttaacctccaaggaactatattagggtttatgactgctttggtgacgatcacgtaatctgtttccagcca |
1276 |
T |
 |
| Q |
216 |
taggttgttccattcatatgcatttgctagctctattg |
253 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1275 |
caggttgttccattcatatgcgtttgctagctctattg |
1238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 247 - 314
Target Start/End: Complemental strand, 3958 - 3891
Alignment:
| Q |
247 |
tctattgccctcattacaccagatatttcagcatgaaaagcgttcccaagaccagtactttccccaaa |
314 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| || | ||| |||| |||||||||||| ||||| |
|
|
| T |
3958 |
tctattgccctcattgcacctgaaatttcagcatgtaaggagttaccaataccagtactttctccaaa |
3891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University