View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13925_low_10 (Length: 442)
Name: NF13925_low_10
Description: NF13925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13925_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 56 - 424
Target Start/End: Complemental strand, 24258921 - 24258553
Alignment:
| Q |
56 |
ttctctttttaagagccttgcccttaattttcttgtgtatatgagcaaaaccaaacctacatgatcctcgcaaaacacacaatcctttaaagacggctaa |
155 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24258921 |
ttctctttttaagagctttgcccttaattttcttgtgtatatgagcaaaaccaaacctacgtgatcctcgcaaaacacacaatcctttaaagacggctaa |
24258822 |
T |
 |
| Q |
156 |
accttcggtgtcagatcccttctaaggaagcatataatcacatcacacattgagtgaacttcactctcaccaactttctcttcaacaactctcacatgca |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24258821 |
accttcggtgtcagatcccttctaaggaagcatataatcacttcacatattgagtgaacttcactctcaccaactttctcttcaacaactctcacatgca |
24258722 |
T |
 |
| Q |
256 |
cttcttttagggtttttaatttagagctttaaaccttgatctctttgaattttgaaaatatattccactctctcttttattataaggttagtctttgact |
355 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24258721 |
cttcttttagggtttttaattcaaagctttaaaccttgatctctttgaattttgaaaatatattccactctctcttttattataaggttagtctttgact |
24258622 |
T |
 |
| Q |
356 |
cttagaagaaaatagtttaggatatggaagagagaaatggttgtgagaaacttgaagaggttatgcttc |
424 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24258621 |
cttagaagaaaatagtttaggatatggaagagagaaatggttgtgagaaacttgaagaggttatgcttc |
24258553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University