View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13926_high_31 (Length: 341)
Name: NF13926_high_31
Description: NF13926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13926_high_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 11 - 323
Target Start/End: Original strand, 36249947 - 36250259
Alignment:
| Q |
11 |
gaagcaattacaaagccaccagaagctcctgtagaaaaggattttacttttgacacccctcaaaaggttgtgaaggattaccaattggatgttgaacagt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36249947 |
gaagcaattacaaagccaccagaagctcctgtagaaaaggattttacttttgacaccccccaaaaggttgtgaaggattaccaattggatgttgaacagt |
36250046 |
T |
|
| Q |
111 |
tcaatggaatggttggaataagatctgcagaagtttcgaagcaagggattgagtatgaagagaatgagtttaatattaagactgctgagatgaggtggtt |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36250047 |
tcaatggaatggttggaacaagatctgcagaagtttcgaagcaagggattgagtatgaagagaatgagtttaatattaagactgctgagatgaggtggtt |
36250146 |
T |
|
| Q |
211 |
tgcagctaaaaagatggaagaagctgcaatggcagccgaagccgttgctctagctgaaatcaaggctctatctggtggtgctgatatatcatcgcgattt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36250147 |
tgcagctaaaaagatggaagaagctgcaatggcagccgaagccgttgctctagctgaaatcaaggctctatctggttgtgctgatatatcatcgcgattt |
36250246 |
T |
|
| Q |
311 |
tctatgcgagaac |
323 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36250247 |
tctatgcgagaac |
36250259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 186 - 285
Target Start/End: Complemental strand, 32501454 - 32501355
Alignment:
| Q |
186 |
ttaagactgctgagatgaggtggtttgcagctaaaaagatggaagaagctgcaatggcagccgaagccgttgctctagctgaaatcaaggctctatctgg |
285 |
Q |
| |
|
||||||| || |||||||||||| ||||||| |||||||||||||||||||||| |||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
32501454 |
ttaagaccgccgagatgaggtggcttgcagccaaaaagatggaagaagctgcaaaggcagcagaagctattgctcttgctgaaatcaaggctctatctgg |
32501355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University