View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13926_high_53 (Length: 240)
Name: NF13926_high_53
Description: NF13926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13926_high_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 153 - 224
Target Start/End: Complemental strand, 15628666 - 15628595
Alignment:
| Q |
153 |
cattgaatgaggtcgttatagacaataaattgtagaatgagggtgaatatcaaggaactttatatgcaaaaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15628666 |
cattgaatgaggtcgttatagacaataaattgtagaatgagggtgagtatcaaggaactttatatgcaaaaa |
15628595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 15628818 - 15628756
Alignment:
| Q |
1 |
ataataaagaaattaaacaccaaaataacttaccaaaaacatgaaataactagagctcataca |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15628818 |
ataataaagaaattaaacaccaaaataacttaccaaaaacatgaaataactagagctcataca |
15628756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University