View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13926_high_56 (Length: 226)
Name: NF13926_high_56
Description: NF13926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13926_high_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 17 - 139
Target Start/End: Complemental strand, 13336210 - 13336088
Alignment:
| Q |
17 |
cacagactaagagagggaggagtacgacggagattacgggaagggatggatggtgagaggaaggagtacgacggagacggagatatgaacagaaaaagtg |
116 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13336210 |
cacagactcagagagggaggagtacggcggagattatgggaagggatggatggtgagaggaaggagtacgacggagacggagatatgaacagaaaaagtg |
13336111 |
T |
 |
| Q |
117 |
gaacttgggtcttgctgtgatta |
139 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13336110 |
gaacttgggtcttgctgtgatta |
13336088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 17 - 139
Target Start/End: Complemental strand, 4462796 - 4462674
Alignment:
| Q |
17 |
cacagactaagagagggaggagtacgacggagattacgggaagggatggatggtgagaggaaggagtacgacggagacggagatatgaacagaaaaagtg |
116 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4462796 |
cacagactcagagagggaggagtatggcggagattacgggaaggaatggatggtgagagggaggagtacgacggagacggagatatgaacagaaaaagag |
4462697 |
T |
 |
| Q |
117 |
gaacttgggtcttgctgtgatta |
139 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4462696 |
gaacttgggtcttgctgtgatta |
4462674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 35 - 139
Target Start/End: Original strand, 36380884 - 36380992
Alignment:
| Q |
35 |
ggagtacgacggagattacgggaagggatggatggtgagaggaaggagtacgacggagacggagatatgaacagaaaaagtggaacttggg----tcttg |
130 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| | |||||||||| ||||| |
|
|
| T |
36380884 |
ggagtacggtggagattacgagaagggatggatgttgagagggaggagtacgacggagacggagatatgaacagaaaaggaggaacttgggtgggtcttg |
36380983 |
T |
 |
| Q |
131 |
ctgtgatta |
139 |
Q |
| |
|
||||||||| |
|
|
| T |
36380984 |
ctgtgatta |
36380992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University