View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13926_high_60 (Length: 210)
Name: NF13926_high_60
Description: NF13926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13926_high_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 92 - 197
Target Start/End: Complemental strand, 5310724 - 5310619
Alignment:
| Q |
92 |
agtttaaacttttattcccattcttaaggactgagaagatgcttcatattcaaaataaacaaaactcaaatgcggtggtggtgatatggaaatgggttga |
191 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5310724 |
agttttaacttttactcccattcttaaggactgagaagatgcttcatattcaaaataaacaaaactcaaatgcggtggtggtgatatggaaatgggttga |
5310625 |
T |
 |
| Q |
192 |
aatttg |
197 |
Q |
| |
|
|||||| |
|
|
| T |
5310624 |
aatttg |
5310619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University