View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13926_low_33 (Length: 346)
Name: NF13926_low_33
Description: NF13926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13926_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 14 - 343
Target Start/End: Complemental strand, 34881012 - 34880668
Alignment:
| Q |
14 |
atgctcctattcaactaactacaacttcatcgatgatttcagcttttcaaacagatgcttctttacaaaagccatttctatacggacatcaaccggggat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34881012 |
atgctcctattcaactaactacaacttcatcgatgatttcagcttttcaaacagatgcttctttacaaaagccatttctatatggacatcaaccggggat |
34880913 |
T |
 |
| Q |
114 |
gctgatcatgttatgattgttggatcctattttcattatgcaggagggtttgaacctcctcagg---------------taattcccgttttgttaagac |
198 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||| |
|
|
| T |
34880912 |
gccgatcatgttatgattgttggatcctattttcattatgcaggagggtttgaacctcctcaggcaattccctcacttttatttcccgttttgttaggac |
34880813 |
T |
 |
| Q |
199 |
aagcttcaagtggcatgaatctttaaactcctcgttctaaattttaatgacctctctccctatttacatattttactgcttagttctccctgcacacaca |
298 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880812 |
aagattcaagtggcatgaatctttaaactcctcgttctaaattttaatgacctctctccctatttacatattttactgcttagttctccctgcacacaca |
34880713 |
T |
 |
| Q |
299 |
ccacctttattatatctgaatcacaactctagcaccaacaaaact |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880712 |
ccacctttattatatctgaatcacaactctagcaccaacaaaact |
34880668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University