View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13926_low_41 (Length: 316)
Name: NF13926_low_41
Description: NF13926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13926_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 9 - 298
Target Start/End: Complemental strand, 29854172 - 29853883
Alignment:
| Q |
9 |
gattatactaatattaaacatgaaagcttctctgaaaatgaggctatcaaagaacatcatgccagtgacagtgaccttgaaacaaatgcagaagaagggt |
108 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29854172 |
gattacactaatatcaaacatgaaagcttctctgaaaatgaggctatcaaagaacatcatacgaatgacagtgaccttgaaacaaatgcagaagaagggt |
29854073 |
T |
 |
| Q |
109 |
tcaaatgcagtgttctttgcatgtttttacggggattcggcaaagcaaagtcagctaaaactaaaaaagaaggatcagaaatggaaggtacgatatcaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29854072 |
tcaaatgcagtgttctttgcatgtttttgccgggattcggcaaagcaaagtcagctaaaactaaaaaagaaggatcagaaatggaaggtacgatatcaag |
29853973 |
T |
 |
| Q |
209 |
gacagtttctttagaaaagtttgaatgtggttcttgggcttcttctgcactattcaatgacattgaaacagacaacacaagttcctattt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29853972 |
gacagtttctttagaaaagtttgaatgtggttcttgggcttcttctgcactatttaatgacattgaaacagacaacacaagttcctattt |
29853883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University