View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13926_low_47 (Length: 258)
Name: NF13926_low_47
Description: NF13926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13926_low_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 82 - 243
Target Start/End: Complemental strand, 46468100 - 46467943
Alignment:
| Q |
82 |
ttaaatcaatctgcatgtttctctcacgtatcatcttacaattttaccaaggttaaaacacataccgaagttggtatcaatcatcaatgcaatcaagaca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46468100 |
ttaaatcaatctgcatgtttctctcacgtatcatcttacaattttaccaaggttaaaacacataccgaagttggtatcaatcatcattgcaatcaagaca |
46468001 |
T |
 |
| Q |
182 |
aaattaacaataaccttgaaaatttaataatttaaaaataggattatatcaaccatcaatct |
243 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46468000 |
aaat----aataaccttgaaaatttaataatttaaaaataggattatatcaaccatcaatct |
46467943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 28 - 90
Target Start/End: Complemental strand, 46468888 - 46468826
Alignment:
| Q |
28 |
ataaacctagaaagttaaaacctataaagaaacctttaggttactcctaggggattaaatcaa |
90 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46468888 |
ataaacctagaaagttaaaacctatacagaaaccattaggttactcctaggggattaaatcaa |
46468826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University