View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13926_low_49 (Length: 255)
Name: NF13926_low_49
Description: NF13926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13926_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 32033861 - 32033639
Alignment:
| Q |
19 |
ataacatcatgatattgcttgtgctacgagaaaactgcatgttgcatactaggttgttattaatcaactataatgtaaataaataagatttaaaatcccg |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32033861 |
ataacatcatgatattgcttgtggtacgagaaaactgcatgttgcatactacgttgttattaatcaactataatgtaaataattaagatttaaaatcccg |
32033762 |
T |
 |
| Q |
119 |
gtcgtaataacaatcacga--tctaatcctatgaagaacgatagttaaatgcaactgcactaggtgaatcataggatcgcatagcgatcacacaacatta |
216 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32033761 |
gtcgtagtaacaatcacgatttctattcctatgaagaacgatagttaaatgcaactacactaggtgaatcataggatcgcatagcgatcacacaacatta |
32033662 |
T |
 |
| Q |
217 |
aaattataatgttatcgacctat |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32033661 |
aaattataatgttatcgacctat |
32033639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University