View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13926_low_53 (Length: 249)
Name: NF13926_low_53
Description: NF13926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13926_low_53 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 92 - 235
Target Start/End: Complemental strand, 30432681 - 30432538
Alignment:
| Q |
92 |
taaccaccaccaataagttaattttataacatctataatctcttccgcttcatagttctttgaagaaaaaataaccttattcctagcctctcatatcttt |
191 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30432681 |
taactaccaccaataagttaattttataacatctatgatctcttccgcttcatagttctttgaagaaaaaataaccttattcctagcctctcatatcttt |
30432582 |
T |
|
| Q |
192 |
caaattgcaccgtacgaaataagatttaacacttttcaatggat |
235 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30432581 |
caaattgtaccgtgcgaaataagatttaacacttttcaatggat |
30432538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 50 - 88
Target Start/End: Complemental strand, 30432749 - 30432711
Alignment:
| Q |
50 |
gcgggtcaaaagtctagttaaatcttaagacaatgaagc |
88 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30432749 |
gcgggtcaagagtctagttaaatcttaagacaatgaagc |
30432711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 30432871 - 30432829
Alignment:
| Q |
1 |
aactaaatacaggggtaggacaactgcattaaatgttgggatg |
43 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
30432871 |
aactaaatataggggtaggacaattgcattaaatgttgggatg |
30432829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University