View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13926_low_63 (Length: 210)

Name: NF13926_low_63
Description: NF13926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13926_low_63
NF13926_low_63
[»] chr5 (1 HSPs)
chr5 (92-197)||(5310619-5310724)


Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 92 - 197
Target Start/End: Complemental strand, 5310724 - 5310619
Alignment:
92 agtttaaacttttattcccattcttaaggactgagaagatgcttcatattcaaaataaacaaaactcaaatgcggtggtggtgatatggaaatgggttga 191  Q
    ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5310724 agttttaacttttactcccattcttaaggactgagaagatgcttcatattcaaaataaacaaaactcaaatgcggtggtggtgatatggaaatgggttga 5310625  T
192 aatttg 197  Q
    ||||||    
5310624 aatttg 5310619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University