View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13926_low_64 (Length: 204)
Name: NF13926_low_64
Description: NF13926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13926_low_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 12 - 181
Target Start/End: Complemental strand, 52780466 - 52780297
Alignment:
| Q |
12 |
agtgagatgaagaggaatagggacaaaaagaatagcatcttggaaagagtatcaaaatctccaacaatagattcccaagccaaactagccacaccaggtg |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52780466 |
agtgacatgaagaggaatagggacaaaaagaatagcatcttggaaagagtatcaaaatctccaacaatagattcccaagccaaactagccacaccaggtg |
52780367 |
T |
|
| Q |
112 |
ctgcaaagaacaagaagaaaactggccttaacaacgcaggaagacgatcaccaccagacaacctttgata |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52780366 |
ctgcaaagaacaagaagaaaactggccttaacaacgcaggaagacgatcaccaccagacaacctttgata |
52780297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 24 - 130
Target Start/End: Complemental strand, 17470967 - 17470861
Alignment:
| Q |
24 |
aggaatagggacaaaaagaatagcatcttggaaagagtatcaaaatctccaacaatagattcccaagccaaactagccacaccaggtgctgcaaagaaca |
123 |
Q |
| |
|
||||| ||||| | |||||| |||||||| ||| ||||||||| | ||| || ||||| ||||||||||||||||| || ||| || |||||||||| |
|
|
| T |
17470967 |
aggaagagggagagaaagaacagcatcttagaagcagtatcaaagtaaccacaaacagattgccaagccaaactagccatactaggagcagcaaagaaca |
17470868 |
T |
|
| Q |
124 |
agaagaa |
130 |
Q |
| |
|
||||||| |
|
|
| T |
17470867 |
agaagaa |
17470861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University