View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13926_low_8 (Length: 513)

Name: NF13926_low_8
Description: NF13926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13926_low_8
NF13926_low_8
[»] chr7 (16 HSPs)
chr7 (17-508)||(6716849-6717338)
chr7 (249-489)||(8744860-8745102)
chr7 (249-490)||(16954361-16954603)
chr7 (396-490)||(42533383-42533478)
chr7 (389-495)||(35745952-35746057)
chr7 (401-496)||(37794859-37794956)
chr7 (405-496)||(38306124-38306217)
chr7 (408-508)||(44755494-44755595)
chr7 (440-495)||(3478251-3478307)
chr7 (404-491)||(47457145-47457233)
chr7 (395-496)||(3419781-3419884)
chr7 (426-495)||(3867000-3867071)
chr7 (395-491)||(5860418-5860516)
chr7 (251-330)||(34389670-34389751)
chr7 (431-491)||(11379257-11379318)
chr7 (396-508)||(16829049-16829162)
[»] chr5 (9 HSPs)
chr5 (249-496)||(13954358-13954606)
chr5 (251-508)||(26046077-26046336)
chr5 (251-496)||(7195363-7195613)
chr5 (360-508)||(7392144-7392290)
chr5 (360-508)||(14302543-14302692)
chr5 (398-508)||(8297325-8297436)
chr5 (418-496)||(34377974-34378054)
chr5 (404-489)||(27712939-27713025)
chr5 (418-509)||(18593119-18593212)
[»] chr8 (5 HSPs)
chr8 (251-508)||(10248666-10248924)
chr8 (401-508)||(17657114-17657222)
chr8 (404-496)||(24995520-24995614)
chr8 (404-496)||(9519361-9519455)
chr8 (420-483)||(31210329-31210393)
[»] scaffold0119 (1 HSPs)
scaffold0119 (253-508)||(42251-42510)
[»] chr2 (19 HSPs)
chr2 (253-508)||(1269192-1269451)
chr2 (251-496)||(41086911-41087159)
chr2 (389-509)||(14106636-14106757)
chr2 (405-489)||(15126535-15126620)
chr2 (405-506)||(17105275-17105377)
chr2 (439-495)||(10173705-10173762)
chr2 (396-480)||(37770782-37770867)
chr2 (440-491)||(2062807-2062859)
chr2 (395-496)||(39338990-39339093)
chr2 (395-495)||(16952508-16952609)
chr2 (395-495)||(17023173-17023274)
chr2 (395-495)||(17060479-17060580)
chr2 (395-495)||(17079024-17079125)
chr2 (418-495)||(7874169-7874247)
chr2 (405-496)||(10523960-10524053)
chr2 (430-490)||(22885263-22885324)
chr2 (440-491)||(15710606-15710658)
chr2 (439-490)||(29487030-29487082)
chr2 (255-329)||(37770934-37771012)
[»] chr6 (6 HSPs)
chr6 (249-496)||(20701928-20702178)
chr6 (370-508)||(3880696-3880835)
chr6 (422-495)||(15132648-15132722)
chr6 (422-495)||(16510427-16510502)
chr6 (405-493)||(32935467-32935556)
chr6 (395-464)||(12793969-12794037)
[»] chr3 (13 HSPs)
chr3 (249-508)||(25647389-25647652)
chr3 (254-508)||(37123102-37123350)
chr3 (354-508)||(4464048-4464205)
chr3 (395-487)||(14755397-14755490)
chr3 (405-483)||(19176366-19176445)
chr3 (404-496)||(20611645-20611739)
chr3 (439-491)||(27398856-27398909)
chr3 (444-495)||(23328475-23328527)
chr3 (249-329)||(14193644-14193726)
chr3 (418-483)||(47235592-47235658)
chr3 (406-491)||(47945577-47945663)
chr3 (395-483)||(2392645-2392734)
chr3 (395-483)||(2394392-2394481)
[»] scaffold0050 (1 HSPs)
scaffold0050 (251-508)||(36412-36675)
[»] chr4 (16 HSPs)
chr4 (352-508)||(25752983-25753140)
chr4 (439-508)||(19672999-19673069)
chr4 (283-508)||(22811272-22811500)
chr4 (429-495)||(19815350-19815417)
chr4 (424-508)||(53823534-53823619)
chr4 (445-508)||(39421126-39421190)
chr4 (389-495)||(31050787-31050894)
chr4 (404-491)||(21988049-21988137)
chr4 (395-496)||(30964294-30964397)
chr4 (440-489)||(46698917-46698967)
chr4 (395-466)||(4305578-4305649)
chr4 (405-460)||(38929698-38929753)
chr4 (439-491)||(6600076-6600129)
chr4 (395-483)||(8254880-8254969)
chr4 (395-483)||(8268298-8268387)
chr4 (403-491)||(12296037-12296126)
[»] scaffold0200 (1 HSPs)
scaffold0200 (342-508)||(19183-19351)
[»] chr1 (18 HSPs)
chr1 (305-479)||(6583333-6583507)
chr1 (370-508)||(16147384-16147523)
chr1 (371-487)||(32864696-32864814)
chr1 (439-508)||(34774770-34774840)
chr1 (293-465)||(10785489-10785656)
chr1 (405-508)||(5389534-5389639)
chr1 (441-509)||(9313401-9313470)
chr1 (439-491)||(42374061-42374114)
chr1 (251-334)||(7857360-7857444)
chr1 (404-495)||(24658793-24658885)
chr1 (351-496)||(30686029-30686175)
chr1 (395-496)||(41920306-41920409)
chr1 (395-508)||(46692932-46693047)
chr1 (360-478)||(52278317-52278436)
chr1 (395-488)||(38544870-38544964)
chr1 (396-491)||(17033441-17033537)
chr1 (405-483)||(20113660-20113739)
chr1 (404-495)||(7857517-7857609)
[»] scaffold0063 (1 HSPs)
scaffold0063 (439-508)||(58025-58095)
[»] scaffold1613 (1 HSPs)
scaffold1613 (395-488)||(1149-1243)
[»] scaffold0068 (1 HSPs)
scaffold0068 (395-483)||(35911-36000)
[»] scaffold0062 (1 HSPs)
scaffold0062 (440-491)||(59518-59570)


Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-174; HSPs: 16)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 17 - 508
Target Start/End: Complemental strand, 6717338 - 6716849
Alignment:
17 acatgtcctacctaagagatcgtgagagctaaaaaagtagattgaatatttttcagagcgtgagagacatttcttacaaaaacataaaattagtcggcaa 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||| ||||    
6717338 acatgtcctacctaagagatcgtgagagctaaaaaagtagattgaataattttcagagtgtgagagacatttctttcaaaaacataaaattagtcagcaa 6717239  T
117 atccttaataaaaaacttcaaacttttgctttcaatggttgggctttaagtcggccttaattgcttataggaaatgtcacatcacaacgtacataactct 216  Q
    |||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
6717238 atccttaataaaaa-cttcaaactttttctttcaatggttgggctttaagtcggccttaattgcttataggaaatgtcacatcacaacgtacatatctct 6717140  T
217 aatttaaaa-gatctctgctttgaaagctgccttttgttactcgggtctttgttcgtcgttactagttcttgtttgttttttg---gagtttttaaggag 312  Q
    ||||||||| ||| | ||||||||||| |||||    ||||||||||||||||||||||| ||||| |||||||| ||||||    | |||||||||| |    
6717139 aatttaaaaagatttatgctttgaaagatgcctcga-ttactcgggtctttgttcgtcgtcactagctcttgttttttttttttttgggtttttaaggtg 6717041  T
313 tttagggtgtttggagggagtgggcctgtttgagctatgcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactt 412  Q
    |||||||||||||||||||||||||| ||| ||||  |||||||| ||||||    ||||||||||||||||||| ||||||||||||||||||||||||    
6717040 tttagggtgtttggagggagtgggcccgtt-gagcagtgccttttccttttg----gtttgttgtttgcacttctgcttattatgtcatttgtcttactt 6716946  T
413 tttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    ||||||||||||||||||||||| | ||||||||| ||| ||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||    
6716945 tttgcgtgctggttttcggtgggccagttacttttactttgagatcgggagtcggtgtctagctgcaatcttatttggcttgatttgatgtttctct 6716849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 249 - 489
Target Start/End: Original strand, 8744860 - 8745102
Alignment:
249 tttgttactcgggtctttgttcgtcgttactagttcttgtttg--ttttttggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgag 346  Q
    |||||||||||| || ||||||||||| |||||  ||||||||  |||||| | ||| |||||| ||||| | |||||||||| || | | ||  |||||    
8744860 tttgttactcggttccttgttcgtcgtcactagcccttgtttgcgttttttcg-gttgttaaggtgtttacgatgtttggaggaagcgagtcttgttgag 8744958  T
347 ctatgcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttt 446  Q
     |  ||||| | |||||||||  ||||||||||||||  |  | ||| ||||| |||||| | ||||||| |||||||||||||||||| | ||||||||    
8744959 ttgagccttctccttttgatctatttgttgtttgcaccaccgcatatcatgtcgtttgtcatgctttttgtgtgctggttttcggtgggccggttacttt 8745058  T
447 tgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttgg 489  Q
    |||||||||||||| || | ||||||||||||||| ||||||||    
8745059 tgcttcgagatcggaaggcggtgtctagctgcaatgttgtttgg 8745102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 249 - 490
Target Start/End: Original strand, 16954361 - 16954603
Alignment:
249 tttgttactcgggtctttgttcgtcgttactagttcttgtttgt-tttttggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgagc 347  Q
    ||||||||||||||  ||||| ||||| ||||  ||| |||||  ||||| || || |||||| ||||||||| |||||||| || ||| ||  |||||     
16954361 tttgttactcgggtacttgtttgtcgtcactatctctagtttgcatttttcga-ttgttaaggtgtttagggtttttggaggtagcgggtctcgttgagt 16954459  T
348 tatgcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttactttt 447  Q
    |  ||||||| |||| |||  |||||||||||||||  || | |||  |||| |||||| |||||  || |||||||||| || |||| |  ||||||||    
16954460 tgagccttttcctttggatatgtttgttgtttgcaccactgcatatcttgtcgtttgtcatacttactgtgtgctggtttccgatgggccgattactttt 16954559  T
448 gcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggc 490  Q
    ||||| |||||| ||| | ||||||||||||||||||| |||||    
16954560 gcttccagatcgagagttggtgtctagctgcaatcttggttggc 16954603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 396 - 490
Target Start/End: Complemental strand, 42533478 - 42533383
Alignment:
396 tgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggc 490  Q
    |||| |||||| ||||||||| |||||||| | || |||| | ||||||||||||||||||||||||||| ||||| ||||||| |||| ||||||    
42533478 tgtcgtttgtcatactttttgtgtgctggtctccgatgggccggttacttttgcttcgagatcgggagtctgtgtccagctgcattcttatttggc 42533383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 495
Target Start/End: Complemental strand, 35746057 - 35745952
Alignment:
389 cttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgttt 487  Q
    ||||| ||||| |||||||| | ||||| ||  |||||||||||||  | |||||||||||||||||||||| || | ||| ||||| ||||||||||||    
35746057 cttatcatgtcgtttgtcttgccttttgtgt--tggttttcggtggaccggttacttttgcttcgagatcggaagttggtgactagcagcaatcttgttt 35745960  T
488 ggcttgat 495  Q
    | ||||||    
35745959 gacttgat 35745952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 401 - 496
Target Start/End: Original strand, 37794859 - 37794956
Alignment:
401 tttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatc-ttgtttggcttgatt 496  Q
    ||||| |||| | ||| |||||||||||||||||| | |||  ||| |||||||||||||||| | | |||||||||||||| ||||||| |||||||    
37794859 tttgttttacatattgtgtgctggttttcggtgggccggttcatttggcttcgagatcgggagttggggtctagctgcaatctttgtttgacttgatt 37794956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 405 - 496
Target Start/End: Original strand, 38306124 - 38306217
Alignment:
405 tcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatc-ttgtttggcttgatt 496  Q
    |||||| | ||| |||||||||||||||||| | |||  ||| ||||||||| |||||||| | |||||||||||||| ||||||| |||||||    
38306124 tcttacatattgtgtgctggttttcggtgggccggttcatttggcttcgagaacgggagtcggggtctagctgcaatctttgtttgacttgatt 38306217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 408 - 508
Target Start/End: Original strand, 44755494 - 44755595
Alignment:
408 tactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtcg-tgtctagctgcaatcttgtttggcttgattggatgtttct 506  Q
    ||||||||| |||||||||  ||||||| |  ||| |||||||| ||| |||||||||| ||||||||||| || ||||||| | ||||| | |||||||    
44755494 tactttttgtgtgctggttagcggtgggcccattaattttgctttgaggtcgggagtcggtgtctagctgctattttgtttgacgtgatttggtgtttct 44755593  T
507 ct 508  Q
    ||    
44755594 ct 44755595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 440 - 495
Target Start/End: Original strand, 3478251 - 3478307
Alignment:
440 ttacttttgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgat 495  Q
    |||||||||||||| ||||||||||| ||| ||||||||||| | ||||||||||||    
3478251 ttacttttgcttcgggatcgggagtcggtgactagctgcaatttggtttggcttgat 3478307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 404 - 491
Target Start/End: Complemental strand, 47457233 - 47457145
Alignment:
404 gtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggct 491  Q
    ||||||||||||| ||||||| ||  |||||| | | |||||||| |||||||||||||| | | |||| |||||| ||||||||||||    
47457233 gtcttactttttgtgtgctggattctggtgggccggatacttttgattcgagatcgggagttggcgtctggctgcattcttgtttggct 47457145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 395 - 496
Target Start/End: Complemental strand, 3419884 - 3419781
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatc-ttgtttggctt 492  Q
    ||||| || ||||||| | ||| |||||||||||||| | | | |||  ||| |||||||||||||||||| | |||||||||||||| ||||||| |||    
3419884 atgtctttcgtcttacatattgtgtgctggttttcggcgagccggttcatttggcttcgagatcgggagtcggggtctagctgcaatctttgtttgactt 3419785  T
493 gatt 496  Q
    ||||    
3419784 gatt 3419781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 426 - 495
Target Start/End: Original strand, 3867000 - 3867071
Alignment:
426 tttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatc-ttgtttggcttgat 495  Q
    ||||||||||||  |||||||||||||||||||| ||||| | |||||||| ||||| ||||||| ||||||    
3867000 tttcggtgggtcgattacttttgcttcgagatcgagagtcggggtctagctacaatctttgtttgacttgat 3867071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 395 - 491
Target Start/End: Complemental strand, 5860516 - 5860418
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtcg-tgtctagctgcaatc-ttgtttggct 491  Q
    ||||| || ||||||| | ||| ||||||||||||| |||| | |||  ||| |||||||||||||||||||  ||||| |||||||| ||||||||||    
5860516 atgtctttcgtcttacatattgtgtgctggttttcgatgggccggttcatttggcttcgagatcgggagtcgaggtctatctgcaatctttgtttggct 5860418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 251 - 330
Target Start/End: Original strand, 34389670 - 34389751
Alignment:
251 tgttactcgggtctttgttcgtcgttactagttcttgtttgttttttg--gagtttttaaggagtttagggtgtttggaggg 330  Q
    |||| |||||||| ||||||||||| ||||| ||| |||| |||||||  | ||| |||||| ||||||| |||||||||||    
34389670 tgttgctcgggtcattgttcgtcgtcactagctctcgttttttttttgttgggttgttaaggtgtttaggttgtttggaggg 34389751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 431 - 491
Target Start/End: Complemental strand, 11379318 - 11379257
Alignment:
431 gtgggtctgttacttttgcttcgagatcgggagtcg-tgtctagctgcaatcttgtttggct 491  Q
    ||||||| |||| ||||| ||| ||||||||||| | ||||||||| |||||||||||||||    
11379318 gtgggtcggttatttttgattcaagatcgggagttggtgtctagctacaatcttgtttggct 11379257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 396 - 508
Target Start/End: Complemental strand, 16829162 - 16829049
Alignment:
396 tgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggcttga 494  Q
    |||| ||||||  |||| ||| |||||||||| || ||||||  ||||||||||||| |||| | ||| | ||||||| ||||||||||| |||||  ||    
16829162 tgtcgtttgtcaaacttattgtgtgctggtttccgatgggtcgattacttttgcttccagattgagagttggtgtctacctgcaatcttggttggcgcga 16829063  T
495 ttggatgtttctct 508  Q
    || | |||||||||    
16829062 tttggtgtttctct 16829049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 102; Significance: 2e-50; HSPs: 9)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 249 - 496
Target Start/End: Complemental strand, 13954606 - 13954358
Alignment:
249 tttgttactcgggtctttgttcgtcgttactagttcttgtttgttttt-tggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgagc 347  Q
    ||||||| || |||||||||||||||| ||||| |||||||||  ||| ||||||| |||||| |||||||||||||||||||||| |||| ||  || |    
13954606 tttgttattcaggtctttgttcgtcgtcactagctcttgtttgcgtttctggagttgttaaggtgtttagggtgtttggagggagttggcccgtg-gaac 13954508  T
348 tatgcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttactttt 447  Q
    |||||||||  |||||| ||||||||||||||||||  |  ||||| ||||| |||||| || ||||||  ||||||||||||||||| | |||||||||    
13954507 tatgcctttaccttttggtcggtttgttgtttgcaccgccgcttatcatgtcgtttgtcataatttttgtatgctggttttcggtgggccggttactttt 13954408  T
448 gcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgatt 496  Q
    |||||||||||  ||||| |||||||||||||||||| |||| |||||||    
13954407 gcttcgagatcaagagtcggtgtctagctgcaatcttatttgacttgatt 13954358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 251 - 508
Target Start/End: Complemental strand, 26046336 - 26046077
Alignment:
251 tgttactcgggtctttgttcgtcgttactagttcttgtttgt-tttttggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgagcta 349  Q
    ||||||||||||| ||||||||| | ||||| |||||||||| ||||||| || ||| ||| ||||||||||||| |||| || ||| |   |||  ||     
26046336 tgttactcgggtccttgttcgtcttcactagctcttgtttgtgtttttggggtgttttaggtgtttagggtgtttagaggaagcgggtcatgttgcactg 26046237  T
350 tgcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgc 449  Q
     ||||| ||||||||||  |||||||||||||||  |  | ||| ||||| |||||| ||||||||| ||||| ||||  ||||||    ||| ||||||    
26046236 agccttcttcttttgatatgtttgttgtttgcaccaccgcatatcatgtcgtttgtcatactttttgtgtgctagtttctggtgggcagattaattttgc 26046137  T
450 ttcgagatcgggagtcg-tgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    ||||||| ||||||||| || |||||||||||||| |||||| ||||| | |||||||||    
26046136 ttcgagaccgggagtcggtggctagctgcaatcttatttggcgtgatttggtgtttctct 26046077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 251 - 496
Target Start/End: Complemental strand, 7195613 - 7195363
Alignment:
251 tgttactcgggtctttgttcgtcgttactagttcttgtttg--ttttttggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgagct 348  Q
    ||||||||||||| ||||| || || ||||| ||||||||   || ||| | ||| |||||| |||||||||||||||||| || | | |  |||| |||    
7195613 tgttactcgggtccttgtttgttgtcactagctcttgtttacattgttttgggttattaaggtgtttagggtgtttggaggaagcgtgtccttttgtgct 7195514  T
349 atgcctttttcttttgatcggtttgttgtttgcacttctacttattatgtca-tttgtcttactttttgcgtgctggtttt-cggtgggtctgttacttt 446  Q
      ||||||| ||||| ||  |||||||||||||||  |  || || || ||| |||||| ||||||||| ||| ||||||| | ||||| | ||||||||    
7195513 gggccttttcctttttatatgtttgttgtttgcaccaccgctcatcatatcattttgtcatactttttgtgtgttggttttccagtgggccagttacttt 7195414  T
447 tgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgatt 496  Q
    ||||||||||||||||||| ||| ||||||||||| ||||||||| |||||    
7195413 tgcttcgagatcgggagtcggtggctagctgcaatattgtttggcgtgatt 7195363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 360 - 508
Target Start/End: Complemental strand, 7392290 - 7392144
Alignment:
360 ttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcg 459  Q
    |||||||||||||||||| ||||| | | || || ||||   ||||||||||||||| ||| |||| |  | |||  | |||||||||||||||||||||    
7392290 ttttgatcggtttgttgtctgcacctatgctcatcatgt---ttgtcttactttttgtgtgttggtatctgatggaccggttacttttgcttcgagatcg 7392194  T
460 ggagtcg-tgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    ||||| | |||||||||||||||||||||||||||||| | |||||||||    
7392193 ggagttggtgtctagctgcaatcttgtttggcttgatttggtgtttctct 7392144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 360 - 508
Target Start/End: Complemental strand, 14302692 - 14302543
Alignment:
360 ttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcg 459  Q
    ||||||||  ||||||||||||||  |  | ||||||||| |||||| | ||||||| ||||||||||  || ||  | |||||||||||||||||||||    
14302692 ttttgatctatttgttgtttgcaccacatcatattatgtcgtttgtcattctttttgtgtgctggtttctgggggccccgttacttttgcttcgagatcg 14302593  T
460 ggagt-cgtgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    ||||| ||||||||||||||| || ||||||| ||||  | |||||||||    
14302592 ggagtccgtgtctagctgcaagctagtttggcgtgatctggtgtttctct 14302543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 398 - 508
Target Start/End: Original strand, 8297325 - 8297436
Alignment:
398 tcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggcttgatt 496  Q
    ||||||||| ||||||||  | |||||||||| ||||| |  |||||||||||||||||||| ||| | ||||||||||||||| |||||| ||||||||    
8297325 tcatttgtcatactttttctgcgctggttttcagtgggccgattacttttgcttcgagatcgagagttggtgtctagctgcaattttgttttgcttgatt 8297424  T
497 ggatgtttctct 508  Q
     | |||||||||    
8297425 tggtgtttctct 8297436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 418 - 496
Target Start/End: Original strand, 34377974 - 34378054
Alignment:
418 gtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtcg-tgtctagctgcaatc-ttgtttggcttgatt 496  Q
    ||||||||||||||| || | |||  ||| |||||||||||||||||||  |||||||||||||| ||||||| |||||||    
34377974 gtgctggttttcggtaggccggttcatttggcttcgagatcgggagtcgaggtctagctgcaatctttgtttgacttgatt 34378054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 404 - 489
Target Start/End: Original strand, 27712939 - 27713025
Alignment:
404 gtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttgg 489  Q
    ||||||||||||| ||||||| ||  | |||| | ||||||||||||||||| ||||||| | | |||||| |||| ||||||||||    
27712939 gtcttactttttgtgtgctggattctgatgggccggttacttttgcttcgaggtcgggagttggcgtctagatgcattcttgtttgg 27713025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 509
Target Start/End: Original strand, 18593119 - 18593212
Alignment:
418 gtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatc-ttgtttggcttgattggatgtttctctc 509  Q
    |||||| ||||||||||| | |||  ||| |||||||||||||||||| | |||||| ||||||| ||||||| ||||||| | | ||||||||    
18593119 gtgctgattttcggtgggccggttcatttggcttcgagatcgggagtcggggtctagttgcaatctttgtttgacttgatttggtttttctctc 18593212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 90; Significance: 3e-43; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 251 - 508
Target Start/End: Complemental strand, 10248924 - 10248666
Alignment:
251 tgttactcgggtctttgttcgtcgttactagttcttgtttg--ttttttggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgagct 348  Q
    ||||||||||||| || |||||||| ||||| |||||||||  ||||||||| || |||||| ||||| |||||||||||||||  || |   |||||||    
10248924 tgttactcgggtccttattcgtcgtcactagctcttgtttgagttttttgga-ttgttaaggtgtttaaggtgtttggagggagcaggtcccgttgagct 10248826  T
349 atgcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttg 448  Q
      | || || |||||||| ||||||||||||||||  ||||||    |||| |||||||||||||| | ||| |||||| ||||||| | ||||||||||    
10248825 tagtctattccttttgattggtttgttgtttgcaccactacttgccttgtcgtttgtcttactttt-gtgtggtggtttccggtgggccagttacttttg 10248727  T
449 cttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    ||||||||||||||||| ||||||||||||||| ||||||||||||||| | |||||||||    
10248726 cttcgagatcgggagtcggtgtctagctgcaattttgtttggcttgatttggtgtttctct 10248666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 401 - 508
Target Start/End: Complemental strand, 17657222 - 17657114
Alignment:
401 tttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgattgga 499  Q
    |||||| ||||||||| ||| |||||| || |||| | |||| |||||||||||||||||||||| ||| |||||| ||||||| |||||| ||||| |     
17657222 tttgtcatactttttgtgtgttggtttccgatgggccggttaattttgcttcgagatcgggagtcggtggctagctacaatcttatttggcgtgatttgg 17657123  T
500 tgtttctct 508  Q
    |||||||||    
17657122 tgtttctct 17657114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 404 - 496
Target Start/End: Complemental strand, 24995614 - 24995520
Alignment:
404 gtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatc-ttgtttggcttgatt 496  Q
    ||||||| | ||| |||||||||||||||||| | |||  ||| |||||||||||||||||| | |||||||||||||| ||||||| |||||||    
24995614 gtcttacatattgtgtgctggttttcggtgggccggttcatttggcttcgagatcgggagtcggggtctagctgcaatctttgtttgacttgatt 24995520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 404 - 496
Target Start/End: Original strand, 9519361 - 9519455
Alignment:
404 gtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatc-ttgtttggcttgatt 496  Q
    ||||||| | ||| |||||||||||| || || | |||  ||| |||||||||||||||||| | |||||||||||||| ||||||| |||||||    
9519361 gtcttacatattgtgtgctggttttcagtaggccggttcatttggcttcgagatcgggagtcggggtctagctgcaatctttgtttgacttgatt 9519455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 420 - 483
Target Start/End: Complemental strand, 31210393 - 31210329
Alignment:
420 gctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatctt 483  Q
    |||||||||||||||| | |||  ||| ||||| |||||||||||| | ||||||||||||||||    
31210393 gctggttttcggtgggccggttcatttggcttcaagatcgggagtcagggtctagctgcaatctt 31210329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 76; Significance: 6e-35; HSPs: 1)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 253 - 508
Target Start/End: Complemental strand, 42510 - 42251
Alignment:
253 ttactcgggtctttgtt-cgtcgttactagttcttgtttgt-tttttggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgagctat 350  Q
    ||||||||||| ||||| |||||| ||||| |||||||||  ||||||| ||| |||| | ||||| |||||||||||||||  |  ||  ||||||||     
42510 ttactcgggtccttgtttcgtcgtcactagctcttgtttgcgtttttggggttgttaaagtgtttatggtgtttggagggagccgatctcattgagctaa 42411  T
351 gcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgct 450  Q
    ||||||| |||| |||  |||||||||||||||  | |  ||| ||||| ||||||||||| ||||  ||||||||  || |||||| |||| |||||||    
42410 gccttttcctttggatatgtttgttgtttgcaccaccatctatcatgtcgtttgtcttactgtttgtatgctggttcccgatgggtcggttaattttgct 42311  T
451 tcgagatcgggagtcg-tgtctagctgcaatcttg-tttggcttgattggatgtttctct 508  Q
    |||||||||||||||| |||||||||||| ||||| |||||||| ||| |||||||||||    
42310 tcgagatcgggagtcgatgtctagctgcattcttgttttggcttaatttgatgtttctct 42251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 76; Significance: 6e-35; HSPs: 19)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 253 - 508
Target Start/End: Original strand, 1269192 - 1269451
Alignment:
253 ttactcgggtctttgtt-cgtcgttactagttcttgtttgt-tttttggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgagctat 350  Q
    ||||||||||| ||||| |||||| ||||| |||||||||  ||||||| ||| |||| | ||||| |||||||||||||||  |  ||  ||||||||     
1269192 ttactcgggtccttgtttcgtcgtcactagctcttgtttgcgtttttggggttgttaaagtgtttatggtgtttggagggagccgatctcattgagctaa 1269291  T
351 gcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgct 450  Q
    ||||||| |||| |||  |||||||||||||||  | |  ||| ||||| ||||||||||| ||||  ||||||||  || |||||| |||| |||||||    
1269292 gccttttcctttggatatgtttgttgtttgcaccaccatctatcatgtcgtttgtcttactgtttgtatgctggttcccgatgggtcggttaattttgct 1269391  T
451 tcgagatcgggagtcg-tgtctagctgcaatcttg-tttggcttgattggatgtttctct 508  Q
    |||||||||||||||| |||||||||||| ||||| |||||||| ||| |||||||||||    
1269392 tcgagatcgggagtcgatgtctagctgcattcttgttttggcttaatttgatgtttctct 1269451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 251 - 496
Target Start/End: Complemental strand, 41087159 - 41086911
Alignment:
251 tgttactcgggtctttgttcgtcgttactagttcttgtttg--ttttttggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgagct 348  Q
    ||||||||||||| || |||||||||||||| |||||| ||  |||||||| ||| |||||| || ||||||||||||||| || ||| |   |||||||    
41087159 tgttactcgggtccttattcgtcgttactagctcttgtatgcgttttttggggttgttaaggtgtctagggtgtttggaggtagcgggtcccgttgagct 41087060  T
349 atgcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttg 448  Q
    | ||||||| || |||||| |||||||| ||||||| |  |||||  |||| |||||| ||||| ||| |||| ||||| ||||||  |  |||||||||    
41087059 aagccttttcctattgatctgtttgttgcttgcactaccgcttatcttgtcgtttgtcctacttgttgtgtgcaggtttccggtggaccgattacttttg 41086960  T
449 cttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgatt 496  Q
    ||| |||||||||| || ||||| |||| |||| ||||||||| |||||    
41086959 ctttgagatcgggaatcggtgtccagctacaattttgtttggcgtgatt 41086911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 389 - 509
Target Start/End: Complemental strand, 14106757 - 14106636
Alignment:
389 cttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatcttgttt 487  Q
    ||||| ||||| | |||||| ||| ||| ||| |||||| ||||||| | ||||||||||||||||||  ||||||| ||| |||||||||||| |||||    
14106757 cttatcatgtcgtctgtcttgcttattgtgtgttggtttccggtgggccggttacttttgcttcgagacagggagtcggtgactagctgcaatcctgttt 14106658  T
488 ggcttgattggatgtttctctc 509  Q
    | ||||||| | |||| |||||    
14106657 gacttgatttggtgttcctctc 14106636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 405 - 489
Target Start/End: Complemental strand, 15126620 - 15126535
Alignment:
405 tcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttgg 489  Q
    |||||||||||| ||||| | ||  |||||||| ||||||||||||||||||||||||| | | ||||||||||| ||||||||||    
15126620 tcttactttttgtgtgctagattctggtgggtcagttacttttgcttcgagatcgggagttggcgtctagctgcattcttgtttgg 15126535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 405 - 506
Target Start/End: Original strand, 17105275 - 17105377
Alignment:
405 tcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgattggatgtt 503  Q
    |||||| | ||| |||||||||| ||||||||| ||||||||||||| |||||  |||||| | |||||||||||| |||||||| ||| ||| | ||||    
17105275 tcttacatattgtgtgctggtttccggtgggtcggttacttttgcttggagataaggagtcggcgtctagctgcaaccttgtttgacttaattaggtgtt 17105374  T
504 tct 506  Q
    |||    
17105375 tct 17105377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 439 - 495
Target Start/End: Complemental strand, 10173762 - 10173705
Alignment:
439 gttacttttgcttcgagatcgggagtcg-tgtctagctgcaatcttgtttggcttgat 495  Q
    |||||||||| |||| |||||| ||||| |||||||||||||||||||||||||||||    
10173762 gttacttttgtttcgggatcggaagtcggtgtctagctgcaatcttgtttggcttgat 10173705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 396 - 480
Target Start/End: Complemental strand, 37770867 - 37770782
Alignment:
396 tgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaat 480  Q
    |||| |||||| | |||||||  |||||||| |||||||| | ||||||||||||||||||||||||| | ||||||||| |||||    
37770867 tgtcgtttgtcatgctttttgtttgctggttatcggtgggccggttacttttgcttcgagatcgggagttggtgtctagcagcaat 37770782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 440 - 491
Target Start/End: Original strand, 2062807 - 2062859
Alignment:
440 ttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggct 491  Q
    |||||||||||||||||||||||| | ||||||||||||| ||||||||||||    
2062807 ttacttttgcttcgagatcgggagttggtgtctagctgcattcttgtttggct 2062859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 395 - 496
Target Start/End: Complemental strand, 39339093 - 39338990
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaat-cttgtttggctt 492  Q
    ||||| || ||||||| | ||| |||||||||||||||||| | |||  ||| |||||||||||||||||| | |||||||||||||  ||||||| |||    
39339093 atgtctttcgtcttacatattgtgtgctggttttcggtgggccagttcatttggcttcgagatcgggagtcggggtctagctgcaatatttgtttgactt 39338994  T
493 gatt 496  Q
    ||||    
39338993 gatt 39338990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 395 - 495
Target Start/End: Complemental strand, 16952609 - 16952508
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggcttg 493  Q
    |||||||||||||||| | ||| ||||||||||||| |||    ||||||||| ||||||||||| ||| | |||| ||| |||||||||||| || |||    
16952609 atgtcatttgtcttacatattgtgtgctggttttcgatggactggttacttttacttcgagatcgagagtttgtgtgtagttgcaatcttgttgggtttg 16952510  T
494 at 495  Q
    ||    
16952509 at 16952508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 395 - 495
Target Start/End: Complemental strand, 17023274 - 17023173
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggcttg 493  Q
    |||||||||||||||| | ||| ||||||||||||| |||    ||||||||| ||||||||||| ||| | |||| ||| |||||||||||| || |||    
17023274 atgtcatttgtcttacatattgtgtgctggttttcgatggactggttacttttacttcgagatcgagagtttgtgtgtagttgcaatcttgttgggtttg 17023175  T
494 at 495  Q
    ||    
17023174 at 17023173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 395 - 495
Target Start/End: Complemental strand, 17060580 - 17060479
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggcttg 493  Q
    |||||||||||||||| | ||| ||||||||||||| |||    ||||||||| ||||||||||| ||| | |||| ||| |||||||||||| || |||    
17060580 atgtcatttgtcttacatattgtgtgctggttttcgatggactggttacttttacttcgagatcgagagtttgtgtgtagttgcaatcttgttgggtttg 17060481  T
494 at 495  Q
    ||    
17060480 at 17060479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 395 - 495
Target Start/End: Original strand, 17079024 - 17079125
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggcttg 493  Q
    |||||||||||||||| | ||| ||||||||||||| |||    ||||||||| ||||||||||| ||| | |||| ||| |||||||||||| || |||    
17079024 atgtcatttgtcttacatattgtgtgctggttttcgatggactggttacttttacttcgagatcgagagtttgtgtgtagttgcaatcttgttgggtttg 17079123  T
494 at 495  Q
    ||    
17079124 at 17079125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 418 - 495
Target Start/End: Original strand, 7874169 - 7874247
Alignment:
418 gtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggcttgat 495  Q
    |||||||| | ||||||| | |||  |||||||||||||||||||| | |||||||||||||||| || ||| ||||||    
7874169 gtgctggtgtccggtgggccggttttttttgcttcgagatcgggagttggtgtctagctgcaatcctgcttgacttgat 7874247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 405 - 496
Target Start/End: Original strand, 10523960 - 10524053
Alignment:
405 tcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtcgtg-tctagctgcaatc-ttgtttggcttgatt 496  Q
    |||||| | ||| |||||||||||||||||  | |||  ||| ||||||||||||||||||| | ||||| ||||||| ||||||| |||||||    
10523960 tcttacatattgtgtgctggttttcggtggaccggttcatttggcttcgagatcgggagtcgggctctagttgcaatctttgtttgacttgatt 10524053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 430 - 490
Target Start/End: Complemental strand, 22885324 - 22885263
Alignment:
430 ggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggc 490  Q
    |||||| | ||||||||||||||||||||||||| | ||||||||||||   ||||||||||    
22885324 ggtgggccggttacttttgcttcgagatcgggagttggtgtctagctgcttccttgtttggc 22885263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 440 - 491
Target Start/End: Original strand, 15710606 - 15710658
Alignment:
440 ttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggct 491  Q
    |||||||||||| ||||||||||| | |||| ||| |||||||||||||||||    
15710606 ttacttttgctttgagatcgggagttggtgtttagttgcaatcttgtttggct 15710658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 439 - 490
Target Start/End: Original strand, 29487030 - 29487082
Alignment:
439 gttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggc 490  Q
    ||||||||||||||||||||||||| | ||||||||||||  |||||| ||||    
29487030 gttacttttgcttcgagatcgggagttggtgtctagctgctttcttgtctggc 29487082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 255 - 329
Target Start/End: Complemental strand, 37771012 - 37770934
Alignment:
255 actcgggtctttgttcgtcgttactagttcttgtttg---ttttttggagtttttaaggag-tttagggtgtttggagg 329  Q
    ||||||||| ||||||||||| ||||| | |||||||   |||||||| ||| |||||| | |||||||||||||||||    
37771012 actcgggtccttgttcgtcgtcactagcttttgtttgcgtttttttggggttgttaaggtgttttagggtgtttggagg 37770934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 72; Significance: 2e-32; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 249 - 496
Target Start/End: Complemental strand, 20702178 - 20701928
Alignment:
249 tttgttactcgggtctttgttcgtcgttactagttcttgtttg--ttttttggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgag 346  Q
    ||||||||||||||| ||||||||||| |||||||||||| ||  ||||||||  || |||||| |||||||||||||||||| || ||| |   |||||    
20702178 tttgttactcgggtccttgttcgtcgtcactagttcttgtatgcattttttgggattgttaaggtgtttagggtgtttggaggaagcgggtcccgttgag 20702079  T
347 ctatgcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttt 446  Q
    |  | | |||| | ||||||| |||||||||||||||| |  | |||  |||  |||||| ||||||||| ||| |||||| || |||| | ||||||||    
20702078 cggtactttttccgtttgatctgtttgttgtttgcactaccgcgtatcttgttgtttgtcctactttttgtgtgatggtttccgatgggccggttacttt 20701979  T
447 tgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgatt 496  Q
    ||||| |||||||||| || ||||||||||||||  ||||||||| |||||    
20701978 tgctttgagatcgggattcggtgtctagctgcaaatttgtttggcgtgatt 20701928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 370 - 508
Target Start/End: Complemental strand, 3880835 - 3880696
Alignment:
370 tttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtg 468  Q
    ||||||||||||||  | || ||| ||||| ||||||  ||||||||  ||||||||| ||||||| | ||||||||||||| ||||||||||||| |||    
3880835 tttgttgtttgcaccaccacatatcatgtcctttgtcagactttttgtttgctggtttccggtgggccagttacttttgctttgagatcgggagtcggtg 3880736  T
469 tctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    ||||||||| |||||||||||| ||||| | |||||||||    
3880735 tctagctgctatcttgtttggcatgatttggtgtttctct 3880696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 422 - 495
Target Start/End: Complemental strand, 15132722 - 15132648
Alignment:
422 tggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgat 495  Q
    |||||||||||||| | ||||||||||||||||||||||||||| ||| |||||||||||| |||||| ||||||    
15132722 tggttttcggtgggccggttacttttgcttcgagatcgggagtcggtgactagctgcaatcctgtttgacttgat 15132648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 422 - 495
Target Start/End: Complemental strand, 16510502 - 16510427
Alignment:
422 tggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatc-ttgtttggcttgat 495  Q
    ||||||||| |||| | ||||||||||||||||||||||||||| | |||||||||||||| ||||||| ||||||    
16510502 tggttttcgttgggccggttacttttgcttcgagatcgggagtcggggtctagctgcaatctttgtttgacttgat 16510427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 405 - 493
Target Start/End: Complemental strand, 32935556 - 32935467
Alignment:
405 tcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggcttg 493  Q
    |||||| | ||| ||||||| || ||||||||| ||||||||||||| |||||| | || | |||||||||||||||||| |||||||||    
32935556 tcttacatattgtgtgctggattccggtgggtcggttacttttgctttgagatcagaagttggtgtctagctgcaatcttctttggcttg 32935467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 395 - 464
Target Start/End: Original strand, 12793969 - 12794037
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagt 464  Q
    |||||||||||||||||| ||| ||||||| ||  | |||||| | | ||||||||||||||||||||||    
12793969 atgtcatttgtcttacttattgtgtgctggattctgatgggtc-ggtccttttgcttcgagatcgggagt 12794037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 69; Significance: 1e-30; HSPs: 13)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 249 - 508
Target Start/End: Original strand, 25647389 - 25647652
Alignment:
249 tttgttactcgggtctttgttcgtcgttactagttcttgtttgt--tttttggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgag 346  Q
    ||||||||||||||| ||||||||||| ||||| ||||||| ||  |||||   ||| |||||| |||||||||||||||||| || | | |   |||||    
25647389 tttgttactcgggtccttgttcgtcgtcactagctcttgttcgtgatttttaaggttgttaaggtgtttagggtgtttggaggaagcgagtcccgttgag 25647488  T
347 ctatgcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtc-ttactttttgcgtgctggttttcggtgggtctgttactt 445  Q
     | |||||||| ||||||| | |||||||||||||||  ||   ||| ||||| |||||| ||  |||||| ||| |||||| || |||| | |||||||    
25647489 ttgtgccttttccttttgacctgtttgttgtttgcaccactgtatatcatgtcgtttgtcattcttttttgtgtgttggtttccgatgggccggttactt 25647588  T
446 ttgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    ||||||||||| |||||||| |||||||||||||||  |||||||| ||||| | |||||||||    
25647589 ttgcttcgagaacgggagtcggtgtctagctgcaattctgtttggcgtgatttggtgtttctct 25647652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 254 - 508
Target Start/End: Original strand, 37123102 - 37123350
Alignment:
254 tactcgggtctttgttcgtcgttactagttcttgtttgt--tttttggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgagctatg 351  Q
    |||||||||| ||||||||||| ||||| ||||||||||  ||||||| ||| ||||||||||||||||||||||||| || |||     ||||| |  |    
37123102 tactcgggtccttgttcgtcgtcactagctcttgtttgtgttttttggggttgttaaggagtttagggtgtttggaggaagcgggttccattgagttgag 37123201  T
352 cctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgctt 451  Q
     ||||| ||||||||| | | ||||||||||| |   |  || ||| |||||||| ||||||||| |||||||||||||         ||||||||||||    
37123202 tcttttccttttgatctgctggttgtttgcaccttcgcacatcatg-catttgtcatactttttgtgtgctggttttcg--------attacttttgctt 37123292  T
452 cgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    |||||||||||||| ||||||||||||||| ||||||||| ||||| | |||||||||    
37123293 cgagatcgggagtcggtgtctagctgcaattttgtttggcgtgatttggtgtttctct 37123350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 354 - 508
Target Start/End: Complemental strand, 4464205 - 4464048
Alignment:
354 tttttcttttgatcggtttgttgtttgcacttctacttattatgtcattt-gtcttactttttgcgtgctggtttt-cggtgggtctgttacttttgctt 451  Q
    |||| |||||||||||||||||||||||||  |  |||||  |||| ||| ||| | ||||||| ||| ||||||| ||||||| | |||||||||||||    
4464205 ttttccttttgatcggtttgttgtttgcaccaccgcttatcttgtcgttttgtcatcctttttgtgtgttggtttttcggtgggccggttacttttgctt 4464106  T
452 cgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    |||||||||||||| |||||||| ||||||||||| |||| ||||| | |||||||||    
4464105 cgagatcgggagtcggtgtctagttgcaatcttgtgtggcgtgatttggtgtttctct 4464048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 395 - 487
Target Start/End: Complemental strand, 14755490 - 14755397
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatcttgttt 487  Q
    |||||||||| | | ||||||| |||||| ||| || |||| | ||||||||||||||||||||||||||| || |||||||||||||||||||    
14755490 atgtcatttgccattctttttgtgtgctgatttccgatgggccggttacttttgcttcgagatcgggagtcggtatctagctgcaatcttgttt 14755397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 405 - 483
Target Start/End: Original strand, 19176366 - 19176445
Alignment:
405 tcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatctt 483  Q
    |||||||| ||| ||||||||||||||||||   ||| |||| ||||||||||| |||||| | ||||||||||||||||    
19176366 tcttacttattgtgtgctggttttcggtgggctggttcctttggcttcgagatcaggagtcggggtctagctgcaatctt 19176445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 404 - 496
Target Start/End: Original strand, 20611645 - 20611739
Alignment:
404 gtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatc-ttgtttggcttgatt 496  Q
    ||||||| | ||| |||||||||||||||||||| |||  ||| | ||||||||| |||||| | |||||||||||||| ||||||| |||||||    
20611645 gtcttacatattgtgtgctggttttcggtgggtcggttcatttggtttcgagatcaggagtcggggtctagctgcaatctttgtttgacttgatt 20611739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 439 - 491
Target Start/End: Original strand, 27398856 - 27398909
Alignment:
439 gttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggct 491  Q
    |||| |||||||||||||||||||| | |||||||||| |||||||||||||||    
27398856 gttatttttgcttcgagatcgggagtttgtgtctagctacaatcttgtttggct 27398909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 444 - 495
Target Start/End: Complemental strand, 23328527 - 23328475
Alignment:
444 ttttgcttcgagatcgggagtcg-tgtctagctgcaatcttgtttggcttgat 495  Q
    ||||||||||||||||||||| | |||||||||||||| ||||||| ||||||    
23328527 ttttgcttcgagatcgggagttggtgtctagctgcaattttgtttgacttgat 23328475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 249 - 329
Target Start/End: Original strand, 14193644 - 14193726
Alignment:
249 tttgttactcgggtctttgttcgtcgttactagttcttgtt--tgttttttggagtttttaaggagtttagggtgtttggagg 329  Q
    ||||||||||||||| || |||||||| ||||| |||||||   | ||||||| ||| |||||| ||||||||| ||||||||    
14193644 tttgttactcgggtccttattcgtcgtcactagctcttgttcgcgatttttggggttgttaaggtgtttagggtttttggagg 14193726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 418 - 483
Target Start/End: Original strand, 47235592 - 47235658
Alignment:
418 gtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatctt 483  Q
    ||||||||||||| |||| | |||  ||| |||||||||||||||||| | ||||||||||||||||    
47235592 gtgctggttttcgatgggccggttcatttggcttcgagatcgggagtcagggtctagctgcaatctt 47235658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 406 - 491
Target Start/End: Original strand, 47945577 - 47945663
Alignment:
406 cttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggct 491  Q
    ||||||||||| ||||||| ||  |||| | | |||||||| |||||||||||||||| | | ||||||| ||| ||||||||||||    
47945577 cttactttttgtgtgctggattctggtgtgccggttactttagcttcgagatcgggagttggcgtctagcagcattcttgtttggct 47945663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 395 - 483
Target Start/End: Complemental strand, 2392734 - 2392645
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatctt 483  Q
    ||||| || ||||||| | ||| ||||||||||||| |||| | |||  ||| ||||| |||||||||||| | ||||||||||||||||    
2392734 atgtctttcgtcttacatattgtgtgctggttttcgatgggacggttcatttggcttcaagatcgggagtcggggtctagctgcaatctt 2392645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 395 - 483
Target Start/End: Complemental strand, 2394481 - 2394392
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatctt 483  Q
    ||||| || ||||||| | ||| ||||||||||||| |||| | |||  ||| ||||| |||||||||||| | ||||||||||||||||    
2394481 atgtctttcgtcttacatattgtgtgctggttttcgatgggacggttcatttggcttcaagatcgggagtcggggtctagctgcaatctt 2394392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 58; Significance: 4e-24; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 251 - 508
Target Start/End: Original strand, 36412 - 36675
Alignment:
251 tgttactcgggtctttgttcgtcgttactagttcttgtt---tgttttttggagtttttaaggag-tttagggtgtttggagggagtgggcctgtttgag 346  Q
    ||||||||||||| ||||||||||| | ||| |||||||     |||||||| ||| |||||| | |||||||||||| |||| || ||  ||  |||||    
36412 tgttactcgggtccttgttcgtcgtcagtagctcttgttcacgtttttttggggttgttaaggtgttttagggtgtttagaggaagcggatctcgttgag 36511  T
347 ctatgcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtc-ttactttttgcgtgctggttttcggtgggtctgttactt 445  Q
    || || ||||| ||||||||  |||||||||||||||  |  | ||| |||||||||||| ||  |||||| ||| |||||| ||||||| |  ||| ||    
36512 ctgtgacttttccttttgatatgtttgttgtttgcaccaccgcatatcatgtcatttgtcattcttttttgtgtgttggtttccggtgggccgattaatt 36611  T
446 ttgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    ||| ||||||||| |||||| ||||||||||||||| ||||||||| ||||| | |||||||||    
36612 ttgattcgagatcaggagtcggtgtctagctgcaattttgtttggcgtgatttggtgtttctct 36675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 58; Significance: 4e-24; HSPs: 16)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 352 - 508
Target Start/End: Original strand, 25752983 - 25753140
Alignment:
352 cctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgctt 451  Q
    |||||| ||||||||   ||||||||||||||  | || ||||||||| |||| |||||||||||  ||||||||| || ||||    ||| ||||||||    
25752983 ccttttccttttgatatatttgttgtttgcacaaccacatattatgtcgtttgccttactttttgtttgctggtttccgatgggcagcttaattttgctt 25753082  T
452 cgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    |||||||||||||| ||||||||||||||||||||||||| ||||  | |||||||||    
25753083 cgagatcgggagtcggtgtctagctgcaatcttgtttggcgtgatgtggtgtttctct 25753140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 439 - 508
Target Start/End: Original strand, 19672999 - 19673069
Alignment:
439 gttacttttgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||  ||| |||||||    
19672999 gttacttttgcttcgagatcgggagtcagtgtctagctgcaatcttgtttggcttgatatgatatttctct 19673069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 283 - 508
Target Start/End: Complemental strand, 22811500 - 22811272
Alignment:
283 tcttgtttg-ttttttggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgagctatgcctttttcttttgatcggtttgtt-gtttg 380  Q
    ||||||||| |||||||  ||| |||||| |||||||| ||||||||| || ||| |   |||| ||| ||||||| ||||||||  |||| || |||||    
22811500 tcttgtttgcttttttgtggttgttaaggtgtttagggagtttggaggaagcgggtcccgttgatctaagccttttccttttgatatgtttttttgtttg 22811401  T
381 cacttctacttattatgtcatttgtcttacttttt-gcgtgctggttttcggtgggtctgttacttttgcttcgagatcggga-gtcgtgtctagctgca 478  Q
    |||| |  | ||| ||||| |||||| | |||||| | |||||||||||||||||||| |||||||||||||||||||||| |  | |||||||| ||||    
22811400 cactaccgcatat-atgtcgtttgtcattcttttttgtgtgctggttttcggtgggtcggttacttttgcttcgagatcggaacttggtgtctagttgca 22811302  T
479 atcttgtttggcttgattggatgtttctct 508  Q
    || ||||||||  ||||| | |||||||||    
22811301 attttgtttggtgtgatttggtgtttctct 22811272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 429 - 495
Target Start/End: Complemental strand, 19815417 - 19815350
Alignment:
429 cggtgggtctgttacttttgcttcgagatcgggagtcg-tgtctagctgcaatcttgtttggcttgat 495  Q
    ||||||| | ||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||    
19815417 cggtgggccagttacttttgcttcgagatcgagagtcggtgtctagctgcaatcttgtttggcttgat 19815350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 424 - 508
Target Start/End: Complemental strand, 53823619 - 53823534
Alignment:
424 gttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    ||||| |||||| | ||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||||| | | |||||||||    
53823619 gtttttggtgggccggttacttttgcttcgagatcgggagtcggtgtctaactgcaatcttgcttggcttgacttggtgtttctct 53823534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 445 - 508
Target Start/End: Complemental strand, 39421190 - 39421126
Alignment:
445 tttgcttcgagatcgggagtcg-tgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    |||||||||||||||||| ||| |||||||||||||||||||||||| ||||| | |||||||||    
39421190 tttgcttcgagatcgggaatcggtgtctagctgcaatcttgtttggcgtgatttggtgtttctct 39421126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 389 - 495
Target Start/End: Complemental strand, 31050894 - 31050787
Alignment:
389 cttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatcttgttt 487  Q
    ||||| ||||| | |||||| ||| ||  ||| |||||| ||||||| | |||||||||||||||||| |||||||| ||| |||||||||||| |||||    
31050894 cttatcatgtcgtctgtcttgcttattatgtgttggtttccggtgggccggttacttttgcttcgagaccgggagtcggtgactagctgcaatcctgttt 31050795  T
488 ggcttgat 495  Q
    | ||||||    
31050794 gacttgat 31050787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 404 - 491
Target Start/End: Complemental strand, 21988137 - 21988049
Alignment:
404 gtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggct 491  Q
    ||||||||||||| ||||||  ||  |||||| | |||||||||| ||||||||| |||| | ||||||||||||| ||||||||||||    
21988137 gtcttactttttgtgtgctgaattctggtgggccggttacttttgtttcgagatcaggagttggtgtctagctgcattcttgtttggct 21988049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 395 - 496
Target Start/End: Original strand, 30964294 - 30964397
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatc-ttgtttggctt 492  Q
    ||||| || ||||||||| ||| ||||||||||||| |||| | |||  ||| ||||||||||||| |||| | |||||||||||||| ||||||| |||    
30964294 atgtctttcgtcttacttattgtgtgctggttttcgatgggccggttcatttggcttcgagatcggaagtcggggtctagctgcaatctttgtttgactt 30964393  T
493 gatt 496  Q
    ||||    
30964394 gatt 30964397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 489
Target Start/End: Complemental strand, 46698967 - 46698917
Alignment:
440 ttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttgg 489  Q
    |||||||||||||||||||||||| | ||||||||||||| ||||||||||    
46698967 ttacttttgcttcgagatcgggagttggtgtctagctgcagtcttgtttgg 46698917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 395 - 466
Target Start/End: Original strand, 4305578 - 4305649
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtcg 466  Q
    ||||| |||||||||| | ||| || ||||||||||||||| | |||  ||| |||||||||||||||||||    
4305578 atgtcttttgtcttacatattgtgtactggttttcggtgggccggttcatttggcttcgagatcgggagtcg 4305649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 405 - 460
Target Start/End: Original strand, 38929698 - 38929753
Alignment:
405 tcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgg 460  Q
    |||||||||||| ||||||| ||  |||||| | ||||||||||||||||||||||    
38929698 tcttactttttgtgtgctggattctggtgggccggttacttttgcttcgagatcgg 38929753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 439 - 491
Target Start/End: Complemental strand, 6600129 - 6600076
Alignment:
439 gttacttttgcttcgagatcgggagtcg-tgtctagctgcaatcttgtttggct 491  Q
    |||| |||||||| |||||||||||| | ||||||| |||||||||||||||||    
6600129 gttaattttgctttgagatcgggagttggtgtctagttgcaatcttgtttggct 6600076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 395 - 483
Target Start/End: Original strand, 8254880 - 8254969
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtcg-tgtctagctgcaatctt 483  Q
    ||||| || ||||||| | ||| ||| |||||||||||||| | |||  ||| |||||||||||||||||||  ||||||||| ||||||    
8254880 atgtctttcgtcttacatattgtgtgttggttttcggtgggccggttcttttggcttcgagatcgggagtcgaggtctagctgtaatctt 8254969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 395 - 483
Target Start/End: Original strand, 8268298 - 8268387
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtcg-tgtctagctgcaatctt 483  Q
    ||||| || ||||||| | ||| ||| |||||||||||||| | |||  ||| |||||||||||||||||||  ||||||||| ||||||    
8268298 atgtctttcgtcttacatattgtgtgttggttttcggtgggccggttcttttggcttcgagatcgggagtcgaggtctagctgtaatctt 8268387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 403 - 491
Target Start/End: Original strand, 12296037 - 12296126
Alignment:
403 tgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggct 491  Q
    |||||||| | ||| ||||||| ||  |||||| |  |||||||||||||||||||||||| | | ||||||||||| |||| |||||||    
12296037 tgtcttacatattgtgtgctggattctggtgggccgattacttttgcttcgagatcgggagttggcgtctagctgcattcttatttggct 12296126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0200 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: scaffold0200
Description:

Target: scaffold0200; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 342 - 508
Target Start/End: Original strand, 19183 - 19351
Alignment:
342 ttgagctatgcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgtt 441  Q
    |||||||  ||||||| |||| |||  |||||||||||||||  | |  ||| ||||| ||||||||||| ||||  ||||||||  || |||||| |||    
19183 ttgagctgagccttttcctttagatatgtttgttgtttgcaccaccatctatcatgtcgtttgtcttactgtttgtatgctggttcccgatgggtcggtt 19282  T
442 acttttgcttcgagatcgggagtc-gtgtctagctgcaatcttg-tttggcttgattggatgtttctct 508  Q
    | |||||||||||||||||||||| ||||||||||||| ||||| |||||||| ||| |||||||||||    
19283 aattttgcttcgagatcgggagtcggtgtctagctgcattcttgttttggcttaatttgatgtttctct 19351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 52; Significance: 1e-20; HSPs: 18)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 305 - 479
Target Start/End: Complemental strand, 6583507 - 6583333
Alignment:
305 ttaaggagtttagggtgtttggagggagtgggcctgtttgagctatgcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttg 404  Q
    |||||| |||||||||||||| ||| |||||| ||  ||| | |  |  |||||||||||||| |||||||||||||||  |  | ||| | ||| || |    
6583507 ttaaggtgtttagggtgtttgaaggaagtgggtctcgttgtgttgagtttttttcttttgatcagtttgttgtttgcaccaccgcatatcacgtcgtt-g 6583409  T
405 tcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaa 479  Q
    || ||||||||| ||| ||||| |||||||| | ||||||||||||||||||||||||||| ||||||||||||||    
6583408 tcatactttttgtgtgttggttgtcggtgggccggttacttttgcttcgagatcgggagtcggtgtctagctgcaa 6583333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 370 - 508
Target Start/End: Original strand, 16147384 - 16147523
Alignment:
370 tttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtcg-tg 468  Q
    ||||||||||||||  |  | ||| |||||||||||||||||| ||| ||| | | || ||||||| |  ||||||||  ||||||||||||||||  ||    
16147384 tttgttgtttgcaccaccgcatatcatgtcatttgtcttacttattgtgtgttaggttccggtgggccgattacttttagttcgagatcgggagtcactg 16147483  T
469 tctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    |||||||||||||||||||||||||||| | |||||||||    
16147484 tctagctgcaatcttgtttggcttgatttggtgtttctct 16147523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 371 - 487
Target Start/End: Complemental strand, 32864814 - 32864696
Alignment:
371 ttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggtttt-cggtgggtctgttacttttgcttcgagatcgggagtc-gtg 468  Q
    ||||||||||||| ||| ||||| ||||| |||||| ||| ||||| ||||| ||||| ||||||| | |||||||||||||||| ||| |||||| |||    
32864814 ttgttgtttgcacctctgcttatcatgtcttttgtcatacgttttgtgtgctagttttccggtgggccggttacttttgcttcgaaatcaggagtcggtg 32864715  T
469 tctagctgcaatcttgttt 487  Q
    ||||||| |||||||||||    
32864714 tctagctacaatcttgttt 32864696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 439 - 508
Target Start/End: Original strand, 34774770 - 34774840
Alignment:
439 gttacttttgcttcgagatcgggagtcg-tgtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    |||||||||||||||||| ||||||||| |||||| || |||||||||||||||||||| |||||||||||    
34774770 gttacttttgcttcgagaacgggagtcggtgtctaactacaatcttgtttggcttgatttgatgtttctct 34774840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 293 - 465
Target Start/End: Complemental strand, 10785656 - 10785489
Alignment:
293 tttttggagtttttaaggagtttagggtgtttggagggagtgggcctgtttgagctatgcctttttcttttgatcggtttgttgtttgcacttctactta 392  Q
    ||||||| ||| |||||| |||||||||||||||||||||  || |   |||||||  ||||||| ||||||||||     ||||||||||  |  | ||    
10785656 tttttggggttgttaaggtgtttagggtgtttggagggagcaggtcccattgagctgagccttttccttttgatcg-----ttgtttgcacccccgccta 10785562  T
393 ttatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc 465  Q
    |  |||  ||||||||||| |||| |||||||||| ||||||| | |||| ||||||||||||||||||||||    
10785561 tcttgtggtttgtcttactgtttgtgtgctggtttccggtgggccggttaattttgcttcgagatcgggagtc 10785489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 405 - 508
Target Start/End: Complemental strand, 5389639 - 5389534
Alignment:
405 tcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagt-cgtgtctagctgcaatc-ttgtttggcttgattggatgt 502  Q
    |||||| | ||| |||||||||||| ||||| | |||  ||| ||||||||||||||||| || |||||||||||||| ||||||| ||||||| ||| |    
5389639 tcttacatattgtgtgctggttttcagtgggccggttcatttggcttcgagatcgggagtccgggtctagctgcaatctttgtttgacttgatttgattt 5389540  T
503 ttctct 508  Q
    ||||||    
5389539 ttctct 5389534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 441 - 509
Target Start/End: Complemental strand, 9313470 - 9313401
Alignment:
441 tacttttgcttcgagatcgggagtcg-tgtctagctgcaatcttgtttggcttgattggatgtttctctc 509  Q
    |||||||||||||||||||||||| | |||||||||||||| ||||||| | ||||| | ||||||||||    
9313470 tacttttgcttcgagatcgggagttggtgtctagctgcaattttgtttgccgtgatttggtgtttctctc 9313401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 439 - 491
Target Start/End: Original strand, 42374061 - 42374114
Alignment:
439 gttacttttgcttcgagatcgggagtc-gtgtctagctgcaatcttgtttggct 491  Q
    |||||||||| |||||||||||||||| |||||||| |||||||||||||||||    
42374061 gttacttttgattcgagatcgggagtcagtgtctagttgcaatcttgtttggct 42374114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 251 - 334
Target Start/End: Original strand, 7857360 - 7857444
Alignment:
251 tgttactcgggtctttgttcgtcgttactagttcttgtttg-ttttttggagtttttaaggagtttagggtgtttggagggagtg 334  Q
    |||||||||||||  |||||||||| ||||| |||||||||  | ||||| ||| | |||| |||||||||||||||||||||||    
7857360 tgttactcgggtccatgttcgtcgtcactagctcttgtttgcgtctttggggttgtcaaggtgtttagggtgtttggagggagtg 7857444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 404 - 495
Target Start/End: Original strand, 24658793 - 24658885
Alignment:
404 gtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggcttgat 495  Q
    ||||||| ||||| |||||||  | ||||||| | |||| ||||||||| |||||||||| | |||||||||||||||| |||||| ||||||    
24658793 gtcttacattttgtgtgctggagtccggtgggccggttatttttgcttcaagatcgggagttggtgtctagctgcaatcatgtttgacttgat 24658885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 351 - 496
Target Start/End: Complemental strand, 30686175 - 30686029
Alignment:
351 gcctttttcttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgct 450  Q
    ||||||| ||||||||| |||||||||||  |||||  ||||   |||| || ||||||| | ||| ||| |||||||||||||| | |||  ||| |||    
30686175 gccttttccttttgatctgtttgttgtttaaacttcg-cttaccttgtctttcgtcttacatattgtgtgttggttttcggtgggccggttcatttggct 30686077  T
451 tcgagatcgggagtcg-tgtctagctgcaat-cttgtttggcttgatt 496  Q
    ||||||||||||||||  ||||| ||||||| |||||||| |||||||    
30686076 tcgagatcgggagtcgaggtctaactgcaatccttgtttgacttgatt 30686029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 395 - 496
Target Start/End: Original strand, 41920306 - 41920409
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatc-ttgtttggctt 492  Q
    ||||| || ||||||| | ||| ||||| |||||||||||| | |||  ||| |||||||||||||||||| | |||||||||||||| ||||||| |||    
41920306 atgtctttcgtcttacatattgtgtgctagttttcggtgggccggttcatttggcttcgagatcgggagtcggggtctagctgcaatctttgtttgactt 41920405  T
493 gatt 496  Q
    ||||    
41920406 gatt 41920409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 395 - 508
Target Start/End: Complemental strand, 46693047 - 46692932
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtcg-tgtctagctgcaatc-ttgtttggctt 492  Q
    ||||| |||||||||| | ||| ||||| |||||||||||| |  ||  ||| |||||||||||||||||||  |||||| ||||||| ||||||| |||    
46693047 atgtcttttgtcttacatattgtgtgctagttttcggtgggccgattcatttggcttcgagatcgggagtcgaggtctagttgcaatctttgtttgactt 46692948  T
493 gattggatgtttctct 508  Q
    |||| ||| |||||||    
46692947 gatttgatttttctct 46692932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 360 - 478
Target Start/End: Original strand, 52278317 - 52278436
Alignment:
360 ttttgatcggtttgttgtttgcacttctacttattatgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcg 459  Q
    |||||||  ||||||||||| |||  |  ||||| ||||| |||||||| ||| ||||||| |||||||||||||  |  ||||||||||||||||| |     
52278317 ttttgatttgtttgttgttttcaccaccgcttatcatgtcgtttgtcttgcttattgcgtgttggttttcggtggaccgattacttttgcttcgagacca 52278416  T
460 ggagtc-gtgtctagctgca 478  Q
    |||| | |||||||||||||    
52278417 ggagccggtgtctagctgca 52278436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 395 - 488
Target Start/End: Complemental strand, 38544964 - 38544870
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtcg-tgtctagctgcaatcttgtttg 488  Q
    ||||| |||||||||| | ||| ||||||| ||   ||||| |  |||||||||||||||||| |||||| | ||||||||||||||||||||||    
38544964 atgtcgtttgtcttacatattgtgtgctggattctagtgggccgattacttttgcttcgagattgggagttggtgtctagctgcaatcttgtttg 38544870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 396 - 491
Target Start/End: Original strand, 17033441 - 17033537
Alignment:
396 tgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcg-ggagtcgtgtctagctgcaatcttgtttggct 491  Q
    |||| |||||||||||| ||| ||||||| ||  |||||| | |||||||||| |||||||||| | | | | |||||| |||||||||||||||||    
17033441 tgtcgtttgtcttacttattgtgtgctggattctggtgggccggttacttttgtttcgagatcgagaattggcgtctagttgcaatcttgtttggct 17033537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 405 - 483
Target Start/End: Complemental strand, 20113739 - 20113660
Alignment:
405 tcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtc-gtgtctagctgcaatctt 483  Q
    |||||| | ||| ||||| |||||||||||| | |||  ||| |||||||||||||||||| | ||||||||||||||||    
20113739 tcttacatattgtgtgctagttttcggtgggccggttcatttggcttcgagatcgggagtcggggtctagctgcaatctt 20113660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 404 - 495
Target Start/End: Original strand, 7857517 - 7857609
Alignment:
404 gtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggcttgat 495  Q
    ||||||| | ||| |||||||||| | ||||| |  ||| |||||||||||||||||||| | |||||||| ||||||  |||||| ||||||    
7857517 gtcttacatattgtgtgctggtttccagtgggccgattatttttgcttcgagatcgggagttggtgtctagttgcaattatgtttgacttgat 7857609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0063 (Bit Score: 51; Significance: 5e-20; HSPs: 1)
Name: scaffold0063
Description:

Target: scaffold0063; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 439 - 508
Target Start/End: Original strand, 58025 - 58095
Alignment:
439 gttacttttgcttcgagatcgggagtcgt-gtctagctgcaatcttgtttggcttgattggatgtttctct 508  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| | |||||||||    
58025 gttacttttgcttcgagatcgggagtcgttgtctagctgcaatcttgtttggcgtgatttggtgtttctct 58095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1613 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold1613
Description:

Target: scaffold1613; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 395 - 488
Target Start/End: Complemental strand, 1243 - 1149
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtcg-tgtctagctgcaatcttgtttg 488  Q
    ||||| |||||||||| | ||| ||||||| ||   ||||| |  |||||||||||||||||| |||||| | ||||||||||||||||||||||    
1243 atgtcgtttgtcttacatattgtgtgctggattctagtgggccgattacttttgcttcgagattgggagttggtgtctagctgcaatcttgtttg 1149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0068 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0068
Description:

Target: scaffold0068; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 395 - 483
Target Start/End: Complemental strand, 36000 - 35911
Alignment:
395 atgtcatttgtcttactttttgcgtgctggttttcggtgggtctgttacttttgcttcgagatcgggagtcg-tgtctagctgcaatctt 483  Q
    ||||| || ||||||| | ||| ||||||| |||||||||| | |||  ||| |||||||||||||||||||  |||||| |||||||||    
36000 atgtctttcgtcttacatattgtgtgctggctttcggtgggccggttcatttggcttcgagatcgggagtcgaggtctagttgcaatctt 35911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0062
Description:

Target: scaffold0062; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 440 - 491
Target Start/End: Original strand, 59518 - 59570
Alignment:
440 ttacttttgcttcgagatcgggag-tcgtgtctagctgcaatcttgtttggct 491  Q
    |||||||||||| ||||||||||| | |||| ||| |||||||||||||||||    
59518 ttacttttgctttgagatcgggagttggtgtttagttgcaatcttgtttggct 59570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University