View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13929_high_7 (Length: 348)
Name: NF13929_high_7
Description: NF13929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13929_high_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 6 - 348
Target Start/End: Original strand, 38720202 - 38720544
Alignment:
| Q |
6 |
ttattgagagaatccaatcttctagtgcaactgcagatactaattcctatagccacggacaaatcaccacttgcaacaatactaaagctcatagtgaaac |
105 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38720202 |
ttatcgagagaatccaatcttctggtgcaactgcagatactaattcctatagccacggacaaatcaccacttgcaaaaatactaaagctcatagtgaaac |
38720301 |
T |
|
| Q |
106 |
ttgtggggcaaatgcaaatcctccaatgttgcagtctgaggtttcatcgtactcgtcaggggttgaagttcaaatagaatcaaacgtatcttacaattta |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38720302 |
ttgtggggcaaatgcaaatcctccaatgttgcagtctgaggtttcatcgtactcgtcaggggttgaagttcaagtagaatcaaacgtatcttacaattta |
38720401 |
T |
|
| Q |
206 |
atggattgtgcagaactgggatccacgtggcaggactggaactgtttagactcaaacatccaagaatttgaacagagcaatgtttttggtgattcagaat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38720402 |
atggattgtgcagaactgggatccacgtggcaggactggaactgtttagactcaaacatccaagaatttgaacagagcaatgtttttggtgattcagaat |
38720501 |
T |
|
| Q |
306 |
tgtggacagatgaaaacatatgtttcttgcagcaacaattggc |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38720502 |
tgtggacagatgaaaacatatgtttcttgcagcaacaattggc |
38720544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 314 - 346
Target Start/End: Complemental strand, 5080381 - 5080349
Alignment:
| Q |
314 |
gatgaaaacatatgtttcttgcagcaacaattg |
346 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
5080381 |
gatgaaaacatatgtttcttgcagcatcaattg |
5080349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University