View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1392_high_6 (Length: 252)
Name: NF1392_high_6
Description: NF1392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1392_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 27771396 - 27771621
Alignment:
| Q |
1 |
tccttgcaaattacacaaatcactaaaagcgcgcaatgaaggcgcctttgaatcaactctactatgatgaatcattgcttcttccataactatttgt--- |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||| || |||||||||||||||| |||||||||| |
|
|
| T |
27771396 |
tccttgcaaattacacaaatcactaaaagcgcgcaatgatggcgccttcgactcaactctactatgttgcatcattgcttcttccacaactatttgttgc |
27771495 |
T |
 |
| Q |
98 |
tcttctgaaaaagtttcagttcttgaaggaagttctataaccgtcgcgggaacttgaacattgtgtattgaagcattcgaagtgaatacgctagaacgac |
197 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||| || | ||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27771496 |
tcttctaaaaaagtttcatttcttgaaggaagttctataattgtaaccggaacttgaacatgatgtgttgaagcattcgaagtgaatacgctagaacgac |
27771595 |
T |
 |
| Q |
198 |
atagaggacaactagagttagattta |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
27771596 |
atagaggacaactagagttagattta |
27771621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University