View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1392_low_11 (Length: 346)
Name: NF1392_low_11
Description: NF1392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1392_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 30 - 335
Target Start/End: Complemental strand, 52344098 - 52343789
Alignment:
| Q |
30 |
cttgctgctagggacggtgttgctgaggtaaatatatacattacaaacacattt---ctatacaatattcttattaattaatttgataataactaagatt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52344098 |
cttgctgctagggacggtgttgctgaggtaaatatatacattacaaacacatttgatctatacaatattcttattaattaatttgataataactaagatt |
52343999 |
T |
|
| Q |
127 |
aaattatgtatagcttggtggacaaagatggaatgtactattaggcagaagagattcaacaacagcaaacttaagtgaagctaatacgttacctgctccc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52343998 |
aaattatgtatagcttggtggacaaagatggaatgtactattaggcagaagagattcaacaacagcaaacttaagtgaagctaatacgttacctgctccc |
52343899 |
T |
|
| Q |
227 |
tttttgaatcttgatggccttatcactgcttttgccaagaaaggtttcacagccgaagaaatggttaccctatcaggtaattaattagtagt-atagtgc |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52343898 |
tttttgaatcttgatggccttatcactgcttttgccaagaaaggtttcacagccgaagaaatggttaccctatcaggtaattaattagtagtaatagtgc |
52343799 |
T |
|
| Q |
326 |
acgcattcat |
335 |
Q |
| |
|
|||||||||| |
|
|
| T |
52343798 |
acgcattcat |
52343789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 199
Target Start/End: Complemental strand, 9155405 - 9155341
Alignment:
| Q |
135 |
tatagcttggtggacaaagatggaatgtactattaggcagaagagattcaacaacagcaaactta |
199 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
9155405 |
tatagcttggcggacaaagctggaatgtaccattaggcagaagagattcaacaacagcaagctta |
9155341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 306
Target Start/End: Original strand, 26951552 - 26951617
Alignment:
| Q |
241 |
tggccttatcactgcttttgccaagaaaggtttcacagccgaagaaatggttaccctatcaggtaa |
306 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||| || ||||||||||| | |||||||||| |
|
|
| T |
26951552 |
tggccttatcaatgcttttaacaataaaggtttcacacccaaagaaatggttgctttatcaggtaa |
26951617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University