View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1392_low_12 (Length: 335)
Name: NF1392_low_12
Description: NF1392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1392_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 80 - 174
Target Start/End: Complemental strand, 13138001 - 13137907
Alignment:
| Q |
80 |
atgaagagttacatatagcatagatgcaaaccaacaccaaaggtttactgcataaatgcattcaaaaaattgatggaaaaatgattcttcatgat |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13138001 |
atgaagagttacatatagcatagatgcaaaccaacaccaaaggtttactgcataaatgcattcaaaaaattgatggaaaaatgattcttcatgat |
13137907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 170 - 243
Target Start/End: Complemental strand, 13137805 - 13137732
Alignment:
| Q |
170 |
atgatgttttttgatatcataggcttctttcaaagataattcacgtgaagtgatgtgtttccaaatcaacctat |
243 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13137805 |
atgatgttttttgaaatcataggcttctttcaaagataattcacgtgaagtgatgtgtttccaaatcaacctat |
13137732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University